UASp regulates expression of Acly cDNA (FBpp0289823) containing a catalytically-dead H772>A variant, and tagged with 3xTag:HA before the stop codon. The sequence targeted by P{TRiP.HMC06049} is mutated to make the UAS line resistant to the shRNA (CACGACCTATGTA- GACCTGTA > TACAACGTACGTGGATTTATA, 8 mutations introduced without affecting the Acly protein sequence).
Scer\GAL4bam.PU/AclyH772A.UASp.Tag:HA fails to rescue AclyHMC06049