A TI{CRIMIC.TG4.0} DNA cassette has been inserted into Prosβ1, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of Prosβ1 downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Prosβ1 : one targeted to a coding intron (ATGGTGGTCTGCAAATAGGTAGG) and the other to a non-coding exon in the 3' UTR (CTGATCGATCTTACTTGGGTAGG). The 3' end of the deletion associated with the insertion extends to within 62bp from the annotated 3' end of the CG8389 gene and may affect its proper 3' end formation.