5 base pairs (AGTAG) immediately downstream of the eggpl start codon have been deleted. In addition, a 28bp region that is 50bp downstream of the ATG codon contains multiple deletions and substitutions. This results in several frameshifts that alter the coding sequence at the 5' end of the coding sequence, but restore the normal reading frame after the 27th codon.
CGGAATCATTTTCAGACAGAATCCAGATGGATCTTTTTCACCTTCTTCTTCACCATTTTCACC
The indicated region contains multiple deletions and insertions that alter the 5' end of the coding sequence after the ATG. The normal reading frame is restored after the 27th codon. The region is replaced with the indicated sequence.