A TI{KozakGAL4} DNA cassette has been inserted into CG13392, replacing all of the protein coding exons of both isoforms (coordinates of deleted sequence are 2L:8381943..8382788 , release 6 genome). This results in a simultaneous knock-out of CG13392 plus a knock-in of GAL4. GAL4 is predicted to be expressed under the control of upstream regulatory sequences of CG13392-RB, but the deletion extends upstream of the 5' end of CG13392-RA and may delete part or all of its upstream regulatory sequences. The 5' end of the deletion associated with the insertion is 73 bp upstream of the 5' end of the Rcd4 gene and may affect its transcription. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TGTATTCAACATTCTCACACCGG and TTGTTAACTAGCTCAAATAGAGG.