A TI{KozakGAL4} DNA cassette has been inserted into Yod1, replacing the coding sequence (coordinates of deleted sequence are 3L:5134359..5135508 , release 6 genome). This results in a simultaneous knock-out of Yod1 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Yod1 (predicted to gene trap all annotated transcripts of the gene). The 3' end of the deletion associated with the insertion is 34 bp upstream of the 5' end of the asRNA:CR45160 gene and may affect its transcription. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CTCTTCGTGTGGGCCTGCGATGG and CTCGCACGGCGATTGTGGCTAGG.