A TI{KozakGAL4} DNA cassette has been inserted into Tsp33B, replacing the coding sequence (coordinates of deleted sequence are 2L:11791105..11792318 , release 6 genome). This results in a simultaneous knock-out of Tsp33B plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Tsp33B (predicted to gene trap all annotated transcripts of the gene). The 5' end of the deletion associated with the insertion is 94 bp downstream of the 3' end of the CG14937 gene and may affect the proper 3' end formation of its transcripts. The 3' end of the deletion associated with the insertion is 94 bp downstream of the 3' end of the CG14932 gene and may affect the proper 3' end formation of its transcripts. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: ACTTTGGATCGATGCCCACGAGG and GAAATGGACGACGAACCGTGTGG.