A TI{CRIMIC.TG4.2} DNA cassette has been inserted into Nach, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of Nach downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.2} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Nach : one targeted to a coding intron (GACTGGAGGAATAAATCAAGTGG) and the other to a non-coding exon in the 3' UTR (AGAGTATATCAAAGTTCATTCGG). The 3' end of the deletion associated with the insertion is 423 bp upstream of the 5' end of the Amyrel gene and may affect its expression.