A TI{CRIMIC.TG4.2} DNA cassette has been inserted into Set1, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of Set1 downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.2} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Set1 : one targeted to a coding intron (GCTATCGATGACAAACCTATGGG) and the other to a non-coding exon in the 3' UTR (AAGTGTACCCCGACATCCTTGGG). The deletion extends to within 50 bp of the 3' end of the MED21 gene and may affect the proper 3' end formation of its transcripts.
