A TI{KozakGAL4} DNA cassette has been inserted into ACXC, replacing the entire coding sequence of the ACXC-RB isoform and part of the ACXC-RA isoform (coordinates of deleted sequence are 2L:12912537..12916669 , release 6 genome). This results in a simultaneous knock-out of ACXC plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of ACXC (predicted to gene trap all annotated transcripts of the gene). The 3' end of the deletion associated with the insertion is 145 bp upstream of the 5' end of the ACXB gene and may affect its transcription. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: AATGAGTGTAGATAATAAGCTGG and AGTTATGTCTTCACTAGATCCGG.