A TI{KozakGAL4} DNA cassette has been inserted into Adsl, replacing the coding sequence (coordinates of deleted sequence are 3R:17019468..17021074 , release 6 genome). This results in a simultaneous knock-out of Adsl plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Adsl (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of Pxd (Adsl is nested within an intron of Pxd). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CGTAATCACAAGGGAAGAGTCGG and AGTGGCTGACGCAGTTGATTGGG.