A TI{KozakGAL4} DNA cassette has been inserted into Alg13, replacing the coding sequence (coordinates of deleted sequence are 3R:29137988..29138604 , release 6 genome and also removes the Alg13 transcription start site). This results in a simultaneous knock-out of Alg13 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Alg13 (predicted to gene trap all annotated transcripts of the gene). The upstream end of the deletion extends to within 58 bp of the 5' end of the superdeath-RA transcript isoform and may affect its expression. The 3' end of the deletion associated with the insertion is 8 bp downstream of the 3' end of the Vha100-1 and may affect the proper 3' end formation of its transcripts. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GAACGTCGTATGAGTAACGCCGG and CACCAAAAGAAGCTTGCATTTGG.