A 'SEED-sfGFP' ('scarless editing by element deletion') cassette has been inserted into the endogenous shf locus. The SEED-sfGFP cassette contains a Disc\RFP^{DsRed(T1).3xP3.cHa} marker flanked on the 5' side by 3 copies of the target site for the 'gRNA#1' guide RNA (sequence of this guide RNA is GTAGTACGATCATAACAACG) and on the 3' side by 3 copies of the target site for the 'gRNA#2' guide RNA (sequence of this guide RNA is GTACATCCATACAGTACCAG), and with the 5' and 3' parts of the split sfGFP sequence sharing a repeated sequence of ~400bp. In addition, a stop codon has been introduced immediately before the target sites for 'gRNA#1', so that the cassette insertion is predicted to generate a truncated protein that preserves only the first 60 amino acids of shf. If double-strand breaks are induced at both guide RNA target sites (by providing Cas9 and both of the 'gRNA#1' and 'gRNA#2' guide RNAs), single-strand annealing (SSA) repair can seamlessly remove the SEED cassette (including the Disc\RFP^{DsRed(T1).3xP3.cHa} marker) and reconstitute a functional sfGFP tag sequence.