UAS regulatory sequences plus the Drosophila Synthetic Core Promoter (DSCP) (from the pNP vector) regulate expression of two shRNAs; the first targets CycC (this hairpin contains an inverted repeat of CAAGGTGTTCCTGTTGATCGA) and the second targets Cdk8 (this hairpin contains an inverted repeat of CAAGGTGTTCCTGTTGATCGA).
Cdk8TH00504.N, CycCTH00504.N, Scer\GAL4ap-md544 has visible | adult stage phenotype
Cdk8TH00504.N, CycCTH00504.N, Scer\GAL4en.PU has abnormal size | larval stage phenotype
Cdk8TH00504.N, CycCTH00504.N, Scer\GAL4ap-md544 has wing phenotype
Cdk8TH00504.N, CycCTH00504.N, Scer\GAL4ap-md544 has wing disc dorsal compartment | larval stage phenotype
Cdk8TH00504.N, CycCTH00504.N, Scer\GAL4en.PU has wing disc | larval stage phenotype
Cdk8TH00504.N, CycCTH00504.N, Scer\GAL4nub-AC-62 has wing disc | larval stage phenotype