UAS regulatory sequences plus the Drosophila Synthetic Core Promoter (DSCP) (from the pNP vector) regulate expression of three shRNAs that each target a different gene; the targets are CycC (hairpin contains an inverted repeat of CACGGCGACGGTTTACTTCAA), Cdk8 (hairpin contains an inverted repeat of CAAGGTGTTCCTGTTGATCGA) and skd (hairpin contains an inverted repeat of GAtGGAGACtAACGAAAtAAA).
Cdk8TH00600.S, CycCTH00600.S, Scer\GAL4ey.PU, skdTH00600.S has visible | adult stage phenotype
Cdk8TH00600.S, CycCTH00600.S, Scer\GAL4ey.PU, skdTH00600.S has decreased size | adult stage phenotype
Cdk8TH00600.S, CycCTH00600.S, Scer\GAL4ey.PU, skdTH00600.S has eye phenotype