A TI{KozakGAL4} DNA cassette has been inserted into AsnS, replacing the entire coding sequence (coordinates of deleted sequence are 3L:21173201..21174891 , release 6 genome and the 5' end of the deletion is within the start codon of AsnS). This results in a simultaneous knock-out of AsnS plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of AsnS (predicted to gene trap all annotated transcripts of the gene). The deletion is also within an intron of the chb-RB transcript and upstream of the transcription start site of the chb-RA and chb-RC transcripts. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: AAAGATAAGCGAGAAATGTGCGG and CAGACTTGCCAATTTACTTAAGG.