A TI{KozakGAL4} DNA cassette has been inserted into CG7706, replacing the coding sequence (coordinates of deleted sequence are 3R:18677837..18680207 , release 6 genome). This results in a simultaneous knock-out of CG7706 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG7706 (predicted to gene trap all annotated transcripts of the gene). The 5' end of the deletion associated with the insertion is 298 bp upstream of the 5' end of the dind gene and may affect its transcription. The 3' end of the deletion associated with the insertion is 397 bp upstream of the common 5' ends of the ChT and CG46318 genes and may affect their transcription. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: AGCAGCTGTTCGGCGCAGTGAGG and AAGTTTGGCTACTAGCCCATTGG.