A TI{KozakGAL4} DNA cassette has been inserted into CG43672, replacing the coding sequence (coordinates of deleted sequence are X:15772989..15778701 , release 6 genome). This results in a simultaneous knock-out of CG43672 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG43672 (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: ATTTGGCAAGGCATTTGAATAGG and TTTACACAATTCGTTTAGTAAGG. The 5' end of the deletion is 4bp downstream of 3' end of the neighboring CG33172 gene and may affect proper 3' end formation of its transcripts.