A TI{KozakGAL4} DNA cassette has been inserted into CG6873, replacing most of the coding sequence (coordinates of deleted sequence are X:18739294..18739778 , release 6 genome, and the 3' end of the deletion is 16bp upstream of the stop codon). This results in a simultaneous knock-out of CG6873 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG6873 (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TGCACTGCGATTGATCCGACTGG and CGAGGAGCAGCTGCGCTCCTTGG.