A TI{KozakGAL4} DNA cassette has been inserted into Pank4, replacing most of the coding sequence (coordinates of deleted sequence are 2L:5094017..5095172 , release 6 genome, and the 3' end of the deletion is 19bp upstream of the stop codon). This results in a simultaneous knock-out of Pank4 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Pank4 (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTATTATGGCAGGTGTGACCAGG and CGTCGTCTGCAAGTTCGAACCGG.