A TI{KozakGAL4} DNA cassette has been inserted into edin, replacing the coding sequence (coordinates of deleted sequence are 3L:17494884..17495255 , release 6 genome). This results in a simultaneous knock-out of edin plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of edin (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of Oatp74D (edin is nested within an intron of Oatp74D).The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTGTTGGAGAACATCTTAGCTGG and CGGGAACATAAGTATTAAGTTGG.