A TI{KozakGAL4} DNA cassette has been inserted into nmdyn-D7, replacing most of the coding sequence (coordinates of deleted sequence are 3R:9680038..9681372 , release 6 genome, and the 3' end of the deletion is 42bp upstream of the stop codon). This results in a simultaneous knock-out of nmdyn-D7 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of nmdyn-D7 (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CTTGCTGTCAAGCGATAGAACGG and AGCTCCAGGTTGGAGTCATCTGG. The 3' end of the deletion is 43bp downstream of the 3' end of the neighboring CG9444 and may affect proper 3' end formation of its transcripts.