Open Close
General Information
Interaction Type
Interacting Genes
FlyBase ID
FBig0000099312
Interaction Network
Interactions Browser links
lncRNA:roX2 network
msl-2 network
esyN Network Diagram
Show neighbor-neighbor interactions:
Select Layout:
Legend:
Protein
RNA
Selected Interactor(s)
Common Interactor(s)
Reported Interactions
FBrf0222154-8.XL.coIP.SEQ
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

MSL2

bait

roX2

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
exon 3
sufficient binding region
nt 606-1112

coordinates relative to transcript roX2-RB

Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

RNA-protein interactions were characterized using the iCLIP protcol (cross-linking and immunoprecipitation). RNA was UV-crosslinked to protein, isolated by immunoprecipitation using msl-2 antibody, and characterized by deep sequencing analysis.

Source was cell extract of clone8 cell line; bait produced from endogenous gene; prey produced from endogenous gene.

Though msl-2 bound to 5,206 sites, roX1 and roX2 sites scored considerably higher, representing over half of all observed cross-linking events.

FBrf0222160-4.PD.WB
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

roX2

bait

MS2 stem loop tag

MSL2

prey

FLAG tag

Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
SLroX2 stem loop
sufficient binding region
CAUUGUACAAGUCGCAAUGCAAACUGAAGUCUUAAAAGACGUGUAAAAUGUUGCAAAUUAAGCAAAUAUAUAUGCAUAUAUGGGUAACGUUUUACGCGCCUUAACCAGUCAAAAUACAAAAUAA

\'roX2-123\'

Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

RNA bait was tagged with MS2 stem loops, and immobilized on amylose beads using a fusion of MS2-binding protein and maltose binding protein (MBP).

Interaction in vitro; bait produced by in vitro transcription; prey produced as a recombinant fusion protein in baculovirus-infected Sf21 cell system.

FBrf0222160-7.EMSA.A
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

MSL2

bait

FLAG tag

roX2

prey

[32]P label

Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
SLroX2 stem loop
sufficient binding region
CAUUGUACAAGUCGCAAUGCAAACUGAAGUCUUAAAAGACGUGUAAAAUGUUGCAAAUUAAGCAAAUAUAUAUGCAUAUAUGGGUAACGUUUUACGCGCCUUAACCAGUCAAAAUACAAAAUAA

\'roX2-123\'

Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Interaction in vitro; bait produced by in vitro transcription; prey produced as a recombinant fusion protein in baculovirus-infected Sf21 cell system.

In the presence of ATP, mle and msl-2 form higher order complexes with roX2.

FBrf0240007-2.CLIP.PCR
Description
physical association
Collection
Cell line used
Participants
Corresponds to
Reported as
Role
Note

MSL2

bait

HA tag

roX2

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was larvae; bait produced from tagged transgenic construct; prey produced from endogenous gene.

External Crossreferences and Linkouts ( 1 )
Linkouts
MIST - An integrated Molecular Interaction Database
References (3)