Open Close
General Information
Interaction Type
Interacting Genes
FlyBase ID
FBig0000099522
Interaction Network
Interactions Browser links
mle network
lncRNA:roX1 network
esyN Network Diagram
Show neighbor-neighbor interactions:
Select Layout:
Legend:
Protein
RNA
Selected Interactor(s)
Common Interactor(s)
Reported Interactions
FBrf0222154-5.XL.coIP.SEQ
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note
mle 

MLE

bait

roX1

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
region D1
sufficient binding region
nt 966-1550

coordinates relative to transcript roX1-RC

region D2
sufficient binding region
nt 2340-2827

coordinates relative to transcript roX1-RC

region D3
sufficient binding region
nt 3394-3843

coordinates relative to transcript roX1-RC

Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

RNA-protein interactions were characterized using the iCLIP protcol (cross-linking and immunoprecipitation). RNA was UV-crosslinked to protein, isolated by immunoprecipitation using mle antibody, and characterized by deep sequencing analysis.

Source was cell extract of clone8 cell line; bait produced from endogenous gene; prey produced from endogenous gene.

Though mle bound to 2,447 sites, roX1 and roX2 sites scored considerably higher, representing over three quarters of all observed cross-linking events.

FBrf0222154-9.PD.WB
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

roX1

bait

boxB tag

mle 

MLE

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
region D1
sufficient binding region
nt 966-1550

coordinates relative to transcript roX1-RC

region D2
sufficient binding region
nt 2340-2827

coordinates relative to transcript roX1-RC

region D3
sufficient binding region
nt 3394-3843

coordinates relative to transcript roX1-RC

Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

RNA-protein interactions were characterized by GRNA chromatography. roX1 RNA was tagged with the boxB RNA element, and bound to glutathione beads by virtue of the interaction between boxB and a GST fusion to the λ[[N22]] peptide. This resin was incubated with nuclear extracts, bound proteins were eluted by RNaseA treatment, and characterized by western blot.

Interaction in vitro; bait produced by in vitro transcription; prey derived from wild-type embryonic nuclear extract.

In this assay, roX1 RNA pulled down mle but not msl-2.

FBrf0222160-1.PD.WB
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

roX1

bait

MS2 stem loop tag

mle 

MLE

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
SLroX1 stem loop
sufficient binding region
CCAUACUAUUCUUAUAUAAGGUUCGUGUUUCGGAAAACGCAUUAAAAGGCGUAAUUUUAAAUCGUUUUCCGAAAUGGGAAUCACAUUUAAACAAU

\'roX1-93\'

Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

RNA bait was tagged with MS2 stem loops, and immobilized on amylose beads using a fusion of MS2-binding protein and maltose binding protein (MBP).

mle binds to a conserved stem loop in roX1 and roX2.

ATP improves the binding affinity and specificity of mle for the conserved roX1/roX2 stem loop.

Interaction in vitro; bait produced by in vitro transcription; prey derived from L2-4 (SL2 cell line derivative) nuclear extract.

FBrf0226202-1.PD.WB
Description
physical association
Collection
Source/Stage
Cell line used
Participants
Corresponds to
Reported as
Role
Note

roX1

bait
mle 

MLE

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Interaction in vitro; bait oligonucleotides synthesized in vitro; prey derived from clone 8 cell extract.

The authors use biotin-tagged oligonucleotides complementary to roX1 to pull down associated factors (protein, RNA or DNA) from cross-linked chromatin.

FBrf0229405-1.PLA
Description
physical association
Collection
Cell line used
Participants
Corresponds to
Reported as
Role
Note

roX1

neutral component

roX1

neutral component

roX1

neutral component
mle 

mle

neutral component
mle 

mle

neutral component
mle 

mle

neutral component
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Factors were detected on polytene chromosomes using antibodies (to proteins) or biotinylated antisense probes (to ncRNA). The PLA signal develops only if probes to the two factors are in close proximity to each other (within tens of nanometers).

Source was larval salivary gland of wild-type fly line; proteins produced from endogenous gene.

FBrf0240007-3.CLIP.PCR
Description
physical association
Collection
Cell line used
Participants
Corresponds to
Reported as
Role
Note
mle 

MLE

bait

roX1

prey
Experimental entities
Corresponds to
Identifier
Reported
Role
Note
Subregions with role in interaction
Corresponds to
Description
Role
Coordinates
Note
Isoform-specific participants
Corresponds to
Description
Role
Note
Comments concerning this interaction

Source was larvae; bait produced from endogenous gene; prey produced from endogenous gene.

External Crossreferences and Linkouts ( 1 )
Linkouts
MIST - An integrated Molecular Interaction Database
References (5)