Subject: RE: FlyBase query
Dear Gillian,
.. concerning your queries:
(1) cdc2-63E was a name given to this gene originally by Steve Stowers \-
but it has now been called L63 or Eip63E (Ecdysone-induced protein 63E)
or CG10579
..
(2) We found that l(3)S070006, l(3)S070016, L(3)02619 and l(3)L6750
fail to complement. And the sequence flanking L(3)L6750 has been
determined \- BLAST searching
with this sequence pulls out CG3874 = frc (see below), as does l(3)10098
which is said to be an allele of frc in flybase. So that was our logic
\- but I guess given what you say about frc being in an intron of another
gene it could be complicated. Looking at the current information now,
l(3)10098 is within the 5'UTR of CG3874 whereas
L(3)L6750 is approx 177 bp 5' to this, but so is l(3)00073 (an allele of
frc) 177 bp 5' to this. So it is likely then if l(3)00073 is an allele
of frc, so is L(3)L6750. We don't have data on the complementation of
l(3)00073 or l(3)10098 with L(3)L6750 to confirm this though. So that's
what we have. I hope that provides some clarification.
Best regards, Helena
________________________________________________________________________
_________
>CG3874-RA type=transcript;
loc= 3L:complement (17396840..17398447);Feature on Genome Map
ID=CG3874-RA; name=frc-RA;
db_xref=FlyBase:FBtr0075228,FlyBase:FBgn0042641,
 Gadfly:CG3874-RA ; species=dmel; len=1608
Length = 1608
Score = 604 bits (314), Expect = e-172 BLAST HIT on Genome Map
Identities = 314/314 (100%)
Strand = Plus / Plus
Query: 177 cacactgaacatatgttccggggagaatggctgcgatttcgcgtcggtaaaaatagcaaa
236
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1 cacactgaacatatgttccggggagaatggctgcgatttcgcgtcggtaaaaatagcaaa
60
Query: 237 tactcgttaatgtgctgtgggaacgcttcctccccggccccaaagtggccccgaagaaag
296
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61 tactcgttaatgtgctgtgggaacgcttcctccccggccccaaagtggccccgaagaaag
120
Query: 297 tgagcaaatgtgcgcgccgcaagatagtcgccgccgaacaaacgatagtgacgaaagtga
356
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 tgagcaaatgtgcgcgccgcaagatagtcgccgccgaacaaacgatagtgacgaaagtga
180
Query: 357 tttaattcaactaccagcactcccgcaaatacgatgagtatgtcgcgcggcggcaacaca
416
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181 tttaattcaactaccagcactcccgcaaatacgatgagtatgtcgcgcggcggcaacaca
240
Query: 417 actctggacttgcagccgctcctggcggagagcgatgtcggaaacagggagctggaggag
476
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241 actctggacttgcagccgctcctggcggagagcgatgtcggaaacagggagctggaggag
300
Query: 477 aagatgggcggatc 490
||||||||||||||
Sbjct: 301 aagatgggcggatc 314
\-----Original Message-----
Sent: Tuesday, 18 January 2005  3:38  AM
To: Richardson Helena
Subject: FlyBase query
Dear Dr. Richardson,
I am curating your paper for FlyBase:
Brumby et al., 2004, Genetics 168(1): 227--251
and I have a couple of questions.
1. In Table 1, one of the candidate genes you list (for the Df(3L)GN50
region) is 'cdc2-63E'.
FlyBase doesn't have a record for a gene with this kind of symbol, but I
am trying to work out if it corresponds to a gene we already have. Do
you know which of the CG predicted gene annotations it corresponds to ?
\- in which case I could rename the CG gene to 'cdc2-63E' in FlyBase.
2. on page 242, in the section where you describe the mapping of the
3.1 complementation group, you state that l(3)S070006 is allelic to
l(3)L6750 and that l(3)L6750 corresponds to frc (fringe connection).
I am wondering how you know this allelism \- I would like to be able to
merge the 'l(3)S070006' and 'l(3)L6750' gene records in with the frc
gene record in FlyBase, however I am a bit nervous because the frc gene
annotation (CG3874) is located within an intron of another gene
(CG32174) so the mapping and complementation data for these P-element
alleles may well be complicated.
Do you have any complementation data for 'l(3)S070006', 'l(3)L6750' and
any particular alleles of frc or any other data which might help clear
this up.
Any info you give me would be recorded as a personal communication to
FlyBase, so that users can see how we knew the information.
thanks,
Gillian
\--------------------------------------------------------------
Gillian Millburn.
FlyBase (Cambridge),
\--------------------------------------------------------------