FlyBase Reference Report: Rubin and Parks, 2011.7.27, P{GMR72E03-GAL4} construct and insertion.

Reference

Citation

Rubin, G.M., Parks, A.L. (2011.7.27). P{GMR72E03-GAL4} construct and insertion.

FlyBase ID

FBrf0214515

Publication Type

Personal communication to FlyBase

Abstract

PubMed ID

PubMed Central ID

Text of Personal Communication

The following information accompanied stocks donated to the Bloomington Drosophila Stock Center by Gerald M. Rubin, Janelia Farm/HHMI.
P{GMR72E03-GAL4} is part of the GMR_Brain_exp_1 construct collection (FBlc0000201) from Pfeiffer et al., 2008 (FBrf0205679). It is composed of a 3985 bp fragment from in or near CG7918 fused upstream of a Drosophila core synthetic promoter (DSCP) followed by the Scer\GAL4 coding region. The vector used was pBPGUw. The fragment was generated using the following primers: primer 1 - GACAGCATGCAGTGGCTTGACTTTT; primer 2 - CGGGGTATGTACTCTTCTGAGTAAG.
P{GMR72E03-GAL4}attP2 is a homozygous viable and fertile insertion into the attP2 site (68A4, 3L:11 ,063,638) on the third chromosome.
--
I blasted the primers to get the coordinates of the GMR72E03 fragment:
3R:3877623..3881608
This puts it in the middle of CG43060 (in and amongst a bunch of other fragments also made for CG7918).
Annette L. Parks, Ph.D.
Bloomington Drosophila Stock Center

DOI

Related Publication(s)

Research paper

Tools for neuroanatomy and neurogenetics in Drosophila.

Pfeiffer et al., 2008, Proc. Natl. Acad. Sci. U.S.A. 105(28): 9715--9720 [FBrf0205679]

Associated Information

Comments

Associated Files

Other Information

Secondary IDs

Language of Publication

English