A 3985 bp fragment from near CG7918 is fused upstream of a Drosophila synthetic core promoter (DSCP) that is followed sequence encoding a GAL4 driver. The fragment was generated using the following primers: primer 1 - GACAGCATGCAGTGGCTTGACTTTT; primer 2 - CGGGGTATGTACTCTTCTGAGTAAG. These primers give the fragment genomic coordinates of 3R:3877623..3881608 (release 5), which correspond to the middle of CG43060, which is the gene adjacent to CG7918.