The following information accompanied stocks donated to the Bloomington Drosophila Stock Center by Julie Moulton and Geoffrey Ganter, University of New England.
The P{TRiP.HMS06033} transgene was generated by the Transgenic RNAi Project (see FBrf0208864). It contains a short inverted repeat for RNAi of gro (hairpin sequence TATTTGAGAGCTGAAGTCGTG) driven by UAS sequences. It was generated by phiC31-mediated integration, using a donor plasmid made using the VALIUM20 vector.
P{TRiP.HMS06033}attP40 is an insertion on the third chromosome in the attP40 landing site.