2L:21,418,512..21,418,649 [+]
2L:21,472,818..21,472,955 [+]
2L:21,467,775..21,467,912 [+]
2L:21,462,732..21,462,869 [+]
2L:21,457,672..21,457,809 [+]
2L:21,452,611..21,452,748 [+]
2L:21,438,570..21,438,707 [+]
2L:21,433,522..21,433,659 [+]
2L:21,428,475..21,428,612 [+]
2L:21,423,414..21,423,551 [+]
Multiple sequence regions exist. Please click on a sequence location for a JBrowse view of the region.
One copy of repeat shown
Sequence
Sequence DownloaderGTGTCAGGATGGACCTGCTTGAGAACCTTGTAAATGTAGATGGCATAGCTCTCCTTCCTTTTGCGCTTCTTTTTCTTGTC GGTCTTGGTGATGTTCTTCTGAGCCTTGCCAGCCTTCTTGGCTGCCTTTCCACTAGTT
genomic DNA
AACTAGTGGAAAGGCAGCCA
GTGTCAGGATGGACCTGCTT
Comprehensive collection of double-strand RNA fragments (1-2 dsRNAs per annotated gene), used for genome-wide RNAi-knockdown assays in cell culture.
The DRSC RNAi screening library was constructed from genomic DNA amplified using Oregon-R strain. In initial collection, most amplicons were designed to FlyBase rel2 at R.Paro's lab (ZMBH Heidelberg). Primers were selected to target the open reading frames (ORF) of known and predicted genes. Regularly updated to accommodate newly identified genes and new gene models, and to replace amplicons with high potential for off-target effects.
