Open Close
General Information
Symbol
Dmel\GMR71G01
Species
D. melanogaster
Feature type
FlyBase ID
FBsf0000166719
Collection
Associated gene
Genomic Location
Chromosome (arm)
X
Sequence location

X:5,537,432..5,541,276

Sequence Data
Length
Comments
Associated Information
Experimental Data
Progenitors
PCR template
Primer 1
ctgctcactggatcttctaattggc
Primer 2
gccttaaagttgccccgagcttgat
Comments
Collection Information
Comments

evidence: Reporter construct (in vivo)

Stocks (3)
External Crossreferences and Linkouts ( 0 )
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
GMR71G01
Secondary FlyBase IDs
    References (5)