The P{CFD4FLPOUT-QUAS-QUAS} construct contains two sgRNAs that each target the QUAS regulatory sequence, with each flanked by a distinct fluorescent reporter. The transgene also contains two pairs of mutually incompatible FRT sites (FRT and FRT3) arranged such that a single FLP-mediated recombination event excises one of the two sgRNAs (plus one of the reporters) in a stochastic manner, with no further recombination possible. The construct has the following structure: FRT site - Avic\GFP^3xP3.cUa marker - sgRNA1 (ATGGAAACGCTCAAATTCGC) - FRT3 site - FRT site - sgRNA2 (CTGGCGGTAGCTGCTCTGAC) - Disc\RFP^mCh.3xP3.cUa marker - FRT3 site.