Open Close
General Information
Symbol
Dmel\Utx-RB
Species
D. melanogaster
Annotation Symbol
CG5640-RB
FlyBase ID
FBtr0080076
Feature type
Associated gene
Evidence Rank
Length (nt)
3446
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 32 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          GTCACATCCCTATTGTATTGATATTAAATTGTTTACTAAATAGATTCTACACGAAACAACACTGCCACTAATATTATATA
          TATATTTGTAAACAATTCACAACGAATTAAAATTAAGACTGCCGAGATTTTTTCGAATAAAAAAAGTGCGTTTACTGGGC
          CATCAAATCGTTTCAGGAGCTTTTATACCTAAGTCCCAATTTTACATGTGCAAATGAAGTTCATTTGCGTCTAGGTCTTA
          TGCTAAAACACTGCGGGGAGTTCCATATTGCCCTAAAACATTTACAATTGGCGCTGCTTTATACATATCCTTCGACCTTT
          TCGGAACTTCAGGTCAAATTTCAAATCGCGCATTTGTACGAAGTTCAAAACAAGCACAAGGCGGCAAAGGATGGCTACGA
          ATTTCTTCTAAATGAGAAAAACATCTCCTTGGAGCTCAAAGCAGATGTTTATCGACAATTAGGATGGATGTACCATTGCG
          TAGAATGCCTAGGCGAAAAAAAGGAACGTGAAGCAAACGCATTAAATTTTCTACAAAAATCAATCGAAGCTGACCCAAAG
          AGTGGACAATCATTATATTTACTAGGAAGGTGTTACGCCGGCATCAATAAGGTTCATGATGCTTTCCTAGCATATCGCAA
          CTCGGTGGAAAAAAGTGAGGGGAATGCTGATACTTGGTGCTCAATCGGCGTCTTATATCAGCAACAAAATCAACCCACGG
          ATGCCCTTCAAGCCTACATATGTGCTGTGCAACTGGATAAAGACCATAAAGCCGCGTGGACCAACCTGGGTATACTTTAT
          GAGAGCTGTGGTCAATTACGAGATGCCTATGCTTGCTACTTAAATGCAACCAAACAAATATCATTCCAGAAGTCTTCGTT
          AATTCGAAAAAAACAAGCAATACGTATGAAAAAGGACACAATTGGACTGTCGAAAGGCCTGTCTCAGAGAATCACTTTCC
          TGGAGGGCCAGCTCAGTCAAGCACCATTGCCAAGTATTACATCCAAGCGCCGCCAGCTGTGTTCAATCGAAGAAGCTTGG
          AACCTGCCAATATCATTAGAAATGAACTCTCGCCAACAACAAACAGCGCAGATGCTACCAAGACAGGTCACAAAGCAAAG
          TCCAGTACAGGGACCGCCACCACCTTATCCGCATAGCCAACTCAGCCAAAGTCCCATACCTTCGAAACGTATTAAGGAAG
          ATGGCACAAGCCAACAAGAAGTAACACAAAACAACAGTCAGACATCAGCGCAAAATCTAATAAACATTTCGGAATCTTTA
          AACCAGCGCAACTTCAACGCCATGCCGGAGAGCAACAAAAGTTCGGAGCAAAGTGTTCTTGACACCTTCGACGACATCTC
          GAATGATATTTATAAACAGAATGAGAGCATCAAGCTCGAACGTTTGAGCCAGGATGCACTGAGTAACAATGAGGACTCGA
          GGCATGATTTTATTGGCGGTGACAACGCCGACATCTCGACCACGTTCAAAATACAAATGGACTCGAAGCAGTTGATGGTA
          GCTGTGAAGCTGCTGCCGATTGATGAACCGCCCGTGCACTGTACCATTTTGCAAGTGAATGCGCCGCCGCCATCTCCGCC
          CGATTGCCCACCGCAGAAACTGACGCGAGATCAACTCCTGCCTCCCACACCCTCTGTTCATTTAGAAAATAAGAAGCACG
          CGTTCAGCCCACAGTTGCAGGAGTTTTGCCTGAAACATCCGATTGCCGTTGTACGCGGCTTAGCGGGCGTCTTGAAGCTA
          GATCTCGGTCTCTTTTCGACCAAAACGTTGGTGGAAGCCAACCCGGACCATAGTGTTGAGGTTCGGACACAAGTGCACCA
          GTCTCCCGATGAAAATTGGGACACTTCGCAGGGTAAGCGCGTCTGGGCCTGCATTTCCCATCGGTCTCACACAACCATAG
          CCAAATATGCCCAATATCAGGCATCCAGTTTTCAAGACAGCTTGAAGCTTATTTTACCGCAGGATGAAAGCGATAAAGGT
          TTCCCCGGCTCGCAAGCAATGTCGGATTCAGACTCAAAGGACTCGGTATCCAATTCGAACATTGTTCTCAAACGTAAAAA
          ACACAAAATAAACAGCAAAATGTTGAGGTTCGGGACCAACGTGGACCTCTCCGATGAAAAGAAATGGAAACCACAATTAA
          CAGAGCTACAAAAACTGCCAGCTTTTGCGCGAGTTATATCCGCTGCCAATATGCTATCACACGTGGGCCACGTCATTTTG
          GGCATGAACACCGTTCAGCTGTACATGAAGGTGCCCGGAAGTAGGACGCCTGGCCACCAAGAGAACAACAACTTCTGCTC
          AATCAACATCAACATCGGTCCTGGCGACTGTGAATGGTTTGCCGTCCCTGACGCCTACTGGGGCGGAGTTCACAATCTTT
          GCGAGAAGAACAACATTAGCTATCTGCACGGCTCGTGGTGGCCCGTCCTGGAGGATTTATACAAGGAGAATATACCAGTT
          TATAGATTTATACAAAAGCCCGGTGACTTGGTTTGGGTGAATGCCGGATGCGTCCATTGGGTTCAGTCGATCGGTTGGTG
          CAACAACATTGCGTGGAATGTTGGACCCTTGACTGCCCGTCAGTATTCTCTTGCCATCGAGCGATATGAGTGGAATAAAG
          TGCAGGCCTTCAAGAGCATTGTGCCGATGGTGCATTTAAGCTGGAATCTTGCAAGGAATATTAAAGTGTCTGATACCAAA
          CTTTTCGAGCTGATAAAAATGTGTTTGCTGCAAACGTTGAAAAACGTATTGCACATACAAGAGTATGTCAAATCGAAAGG
          TGTGGAAATACGTTTCAATGGACGCGGAAAGAACGAAGCATCCCATTACTGCGGACAATGCGAGGTTGAGGTTTTCAATG
          TGCTGTTCATCAAGGAGCAGGAGAAACGACATGTGGTCCACTGCCTATCGTGCGCGCTGAAGCTATCTCCGTCGCTCCAG
          GGAATCGTTTGCCTGGAGGAGTATCGTCTGTCTGAGCTGCAGCGCGTGTACGATTCGTTTACTTTACACAGAACCCAAGG
          ACTAGCATACACTCAGTAGTTGTAATACGAGGAATCATTTTAAGTAATGCAGATTTAATATATGTATATTTTACAACGTA
          CAATATACTCTCTATTGTTTTGATAAAACATAACGGTACGAATATATAGAGATGGGATTTTTCGAATAAAGCCATCAGAG
          CAGTTTTTTCGGCTATTATGTTTGATAGTCGAAAAAACTGGAGCCCACTTGAGTAGCGAAACTTACCTTATGATGACAAT
          TTTATTATGACTTCAAATATTTAGACCCATCTTTTATAGTTTAATTTAAAAAAAAAAACTTTAAATTTATCCAAAGTTTA
          GAATGCGTTTTAATTATATATATGAATAAATTTAATTTATAATCTTTCGCAATGACACTGAAATTAAAATCCTTCTTTTT
          ATTGAA
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0080075
          3609
          FBtr0080077
          3132
          FBtr0303903
          3591
          FBtr0333410
          3322
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0079665
          939
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0079664
          1136
          FBpp0079666
          939
          FBpp0292906
          1130
          FBpp0305602
          934
          Comments

          Extended 3' UTR based on RNA-Seq and/or EST data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (3)
          Reported As
          Symbol Synonym
          CG5640-RA
          CG5640-RB
          Utx-RB
          Secondary FlyBase IDs
            References (2)