Open Close
General Information
Symbol
Dmel\Utx-RC
Species
D. melanogaster
Annotation Symbol
CG5640-RC
FlyBase ID
FBtr0080077
Feature type
Associated gene
Evidence Rank
Length (nt)
3132
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 19 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GTCACATCCCTATTGTATTGATATTAAATTGTTTACTAAATAGATTCTACACGAAACAACACTGCCACTAATATTATATA
        TATATTTGTAAACAATTCACAACGAATTAAAATTAAGACTGCCGAGATTTTTTCGAATAAAAAAAGGCCATCAAATCGTT
        TCAGGAGCTTTTATACCTAAGTCCCAATTTTACATGTGCAAATGAAGTTCATTTGCGTCTAGGTCTTATGCTAAAACACT
        GCGGGGAGTTCCATATTGCCCTAAAACATTTACAATTGGCGCTGCTTTATACATATCCTTCGACCTTTTCGGAACTTCAG
        GTCAAATTTCAAATCGCGCATTTGTACGAAGTTCAAAACAAGCACAAGGCGGCAAAGGATGGCTACGAATTTCTTCTAAA
        TGAGAAAAACATCTCCTTGGAGCTCAAAGCAGATGTTTATCGACAATTAGGATGGATGTACCATTGCGTAGAATGCCTAG
        GCGAAAAAAAGGAACGTGAAGCAAACGCATTAAATTTTCTACAAAAATCAATCGAAGCTGACCCAAAGAGTGGACAATCA
        TTATATTTACTAGGAAGGTGTTACGCCGGCATCAATAAGGTTCATGATGCTTTCCTAGCATATCGCAACTCGGTGGAAAA
        AAGTGAGGGGAATGCTGATACTTGGTGCTCAATCGGCGTCTTATATCAGCAACAAAATCAACCCACGGATGCCCTTCAAG
        CCTACATATGTGCTGTGCAACTGGATAAAGACCATAAAGCCGCGTGGACCAACCTGGGTATACTTTATGAGAGCTGTGGT
        CAATTACGAGATGCCTATGCTTGCTACTTAAATGCAACCAAACAAATATCATTCCAGAAGTCTTCGTTAATTCGAAAAAA
        ACAAGCAATACGTATGAAAAAGGACACAATTGGACTGTCGAAAGGCCTGTCTCAGAGAATCACTTTCCTGGAGGGCCAGC
        TCAGTCAAGCACCATTGCCAAGTATTACATCCAAGCGCCGCCAGCTGTGTTCAATCGAAGAAGCTTGGAACCTGCCAATA
        TCATTAGAAATGAACTCTCGCCAACAACAAACAGCGCAGATGCTACCAAGACAGGTCACAAAGCAAAGTCCAGTACAGGG
        ACCGCCACCACCTTATCCGCATAGCCAACTCAGCCAAAGTCCCATACCTTCGAAACGTATTAAGGAAGATGGCACAAGCC
        AACAAGAAGTAACACAAAACAACAGTCAGACATCAGCGCAAAATCTAATAAACATTTCGGAATCTTTAAACCAGCGCAAC
        TTCAACGCCATGCCGGAGAGCAACAAAAGTTCGGAGCAAAGTGTTCTTGACACCTTCGACGACATCTCGAATGATATTTA
        TAAACAGAATGAGAGCATCAAGCTCGAACGTTTGAGCCAGGATGCACTGAGTAACAATGAGGACTCGAGGCATGATTTTA
        TTGGCGGTGACAACGCCGACATCTCGACCACGTTCAAAATACAAATGGACTCGAAGCAGTTGATGGTAGCTGTGAAGCTG
        CTGCCGATTGATGAACCGCCCGTGCACTGTACCATTTTGCAAGTGAATGCGCCGCCGCCATCTCCGCCCGATTGCCCACC
        GCAGAAACTGACGCGAGATCAACTCCTGCCTCCCACACCCTCTGTTCATTTAGAAAATAAGAAGCACGCGTTCAGCCCAC
        AGTTGCAGGAGTTTTGCCTGAAACATCCGATTGCCGTTGTACGCGGCTTAGCGGGCGTCTTGAAGCTAGATCTCGGTCTC
        TTTTCGACCAAAACGTTGGTGGAAGCCAACCCGGACCATAGTGTTGAGGTTCGGACACAAGTGCACCAGTCTCCCGATGA
        AAATTGGGACACTTCGCAGGGTAAGCGCGTCTGGGCCTGCATTTCCCATCGGTCTCACACAACCATAGCCAAATATGCCC
        AATATCAGGCATCCAGTTTTCAAGACAGCTTGAAGCTTATTTTACCGCAGGATGAAAGCGATAAAGGTTTCCCCGGCTCG
        CAAGCAATGTCGGATTCAGACTCAAAGGACTCGGTATCCAATTCGAACATTGTTCTCAAACGTAAAAAACACAAAATAAA
        CAGCAAAATGTTGAGGTTCGGGACCAACGTGGACCTCTCCGATGAAAAGAAATGGAAACCACAATTAACAGAGCTACAAA
        AACTGCCAGCTTTTGCGCGAGTTATATCCGCTGCCAATATGCTATCACACGTGGGCCACGTCATTTTGGGCATGAACACC
        GTTCAGCTGTACATGAAGGTGCCCGGAAGTAGGACGCCTGGCCACCAAGAGAACAACAACTTCTGCTCAATCAACATCAA
        CATCGGTCCTGGCGACTGTGAATGGTTTGCCGTCCCTGACGCCTACTGGGGCGGAGTTCACAATCTTTGCGAGAAGAACA
        ACATTAGCTATCTGCACGGCTCGTGGTGGCCCGTCCTGGAGGATTTATACAAGGAGAATATACCAGTTTATAGATTTATA
        CAAAAGCCCGGTGACTTGGTTTGGGTGAATGCCGGATGCGTCCATTGGGTTCAGTCGATCGGTTGGTGCAACAACATTGC
        GTGGAATGTTGGACCCTTGACTGCCCGTCAGTATTCTCTTGCCATCGAGCGATATGAGTGGAATAAAGTGCAGGCCTTCA
        AGAGCATTGTGCCGATGGTGCATTTAAGCTGGAATCTTGCAAGGAATATTAAAGTGTCTGATACCAAACTTTTCGAGCTG
        ATAAAAATGTGTTTGCTGCAAACGTTGAAAAACGTATTGCACATACAAGAGTATGTCAAATCGAAAGGTGTGGAAATACG
        TTTCAATGGACGCGGAAAGAACGAAGCATCCCATTACTGCGGACAATGCGAGGTTGAGGTTTTCAATGTGCTGTTCATCA
        AGGAGCAGGAGAAACGACATGTGGTCCACTGCCTATCGTGCGCGCTGAAGCTATCTCCGTCGCTCCAGGGAATCGTTTGC
        CTGGAGGAGTATCGTCTGTCTGAGCTGCAGCGCGTGTACGATTCGTTTACTTTACACAGAACCCAAGGACTAGCATACAC
        TCAGTAGTTGTAATACGAGGAATCATTTTAAGTAATGCAGATTTAATATATGTATATTTTACAACGTACAATATACTCTC
        TATTGTTTTGAT
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0080075
        3609
        FBtr0080076
        3446
        FBtr0303903
        3591
        FBtr0333410
        3322
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0079666
        939
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0079664
        1136
        FBpp0079665
        939
        FBpp0292906
        1130
        FBpp0305602
        934
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG5640-RC
        Utx-RC
        Secondary FlyBase IDs
          References (2)