Open Close
General Information
Symbol
Dmel\Hsc70-4-RE
Species
D. melanogaster
Annotation Symbol
CG4264-RE
FlyBase ID
FBtr0083055
Feature type
Associated gene
Evidence Rank
Length (nt)
2284
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 381 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        GCAGTCACAGTCTACTTTCGGTTGAGTGAATGTCTAAAGCTCCTGCTGTTGGTATTGATTTGGGCACCACCTACTCGTGC
        GTGGGCGTGTTCCAGCATGGCAAGGTCGAGATCATCGCCAACGACCAGGGTAATCGTACCACTCCATCCTATGTTGCCTT
        CACCGATACGGAGCGTCTGATCGGAGATGCCGCCAAGAACCAGGTGGCGATGAACCCGACCCAGACGATCTTCGACGCCA
        AGCGCTTGATTGGTCGCAAGTTCGATGATGCCGCCGTGCAGTCTGACATGAAGCACTGGCCCTTCGAGGTGGTCAGCGCC
        GATGGCAAGCCCAAGATCGAGGTGACCTACAAGGACGAGAAGAAGACCTTCTTCCCCGAGGAGATCTCTTCGATGGTGCT
        TACCAAGATGAAGGAGACCGCCGAGGCCTATCTGGGCAAGACTGTGACCAACGCGGTCATCACCGTGCCGGCCTACTTCA
        ACGACTCTCAGCGTCAGGCGACCAAGGACGCCGGCACCATCGCCGGTCTGAACGTGCTGCGTATCATCAACGAGCCCACT
        GCCGCTGCTATCGCTTACGGTCTGGACAAGAAGGCTGTTGGAGAGCGCAACGTGCTCATCTTCGATCTGGGCGGCGGCAC
        CTTCGATGTGTCCATCCTGTCGATCGATGACGGTATCTTTGAGGTCAAGTCCACGGCCGGAGATACGCATCTGGGTGGTG
        AGGACTTCGACAACCGTCTGGTCACCCACTTCGTGCAGGAGTTCAAGCGCAAGCACAAGAAGGATCTGACCACCAACAAG
        CGTGCTCTGCGTCGTCTGCGCACCGCTTGCGAGCGTGCAAAGCGTACCCTGTCGTCCTCCACCCAGGCCAGCATTGAGAT
        CGACTCTCTGTTCGAGGGTACCGACTTCTACACCTCGATTACTCGTGCCCGTTTCGAGGAGTTGAACGCTGATCTGTTCC
        GCAGCACCATGGACCCCGTGGAGAAGGCTCTGCGTGACGCCAAGCTGGACAAGTCGGTCATCCACGACATTGTGCTGGTC
        GGTGGCTCCACCCGTATCCCCAAGGTGCAGCGCCTGCTGCAGGATCTGTTCAATGGCAAGGAGCTGAACAAGTCGATCAA
        TCCCGATGAGGCTGTGGCCTACGGTGCTGCCGTCCAGGCCGCCATTCTGCACGGCGACAAGTCGCAGGAGGTGCAGGATC
        TGCTGCTGCTCGATGTGACTCCTCTGTCCCTGGGTATCGAAACCGCTGGCGGTGTGATGAGCGTGTTGATCAAGCGCAAC
        ACCACCATCCCGACCAAGCAGACCCAGACCTTCACCACCTACTCGGACAACCAGCCCGGTGTGCTGATCCAGGTGTACGA
        GGGAGAGCGTGCCATGACCAAGGACAACAACCTGCTCGGCAAGTTCGAGCTGTCGGGCATCCCCCCCGCACCACGTGGTG
        TGCCCCAGATCGAGGTCACCTTCGATATCGATGCCAACGGTATCCTCAACGTGACTGCCCTGGAGCGTTCGACCAACAAG
        GAGAACAAGATCACCATTACCAACGACAAGGGTCGTCTCTCCAAGGAGGACATCGAGCGCATGGTCAACGAGGCCGAGAA
        GTACCGCAACGAGGATGAGAAGCAGAAGGAGACCATTGCCGCCAAGAACGGCCTCGAGTCGTACTGCTTCAACATGAAGG
        CCACCCTCGACGAGGATAACCTGAAGACCAAGATCTCGGACTCTGACCGCACCACAATCCTGGACAAGTGCAACGAGACC
        ATCAAGTGGCTGGATGCCAACCAGCTGGCTGACAAGGAGGAGTACGAGCACCGCCAGAAGGAACTGGAGGGTGTGTGCAA
        CCCGATCATTACCAAGCTATACCAGGGCGCCGGTTTCCCACCCGGTGGCATGCCCGGCGGTCCCGGAGGTATGCCCGGAG
        CGGCTGGTGCCGCTGGCGCTGCCGGAGCCGGCGGTGCTGGCCCCACCATCGAGGAGGTCGACTAAACCATTCACCCCCAC
        ACCTCAATGCAACCATACAGTAACAGTTCTCCAAACAATTTACCAACCAAACACAGTAGAAGAGTTGCTTAAACAAACTT
        GGATTCTAAATTAGGAACTCGCCAAACATACAAACGGGTCAAACGACAACTGCTCCCCGTAGTTCATTTATATAAATTAT
        AAATTCATACTAGAACAAAACCAAACACACTGCTCCATAATAGTATATATTATATTATTGTCATCGATCGATCATCCAAA
        CTATTTGCTTGTACTTGAATTCAATAAATAAATTTGAGAATTGC
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0083057
        2368
        FBtr0083060
        2339
        FBtr0083058
        2280
        FBtr0083059
        2352
        FBtr0083056
        2359
        FBtr0337053
        2336
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0082514
        651
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0082516
        651
        FBpp0082519
        651
        FBpp0082517
        651
        FBpp0082518
        651
        FBpp0082515
        651
        FBpp0307982
        651
        Comments

        Transcript terminates at site supported by polyadenylated cDNA.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG4264-RE
        Hsc70-4-RE
        Secondary FlyBase IDs
          References (2)