Open Close
General Information
Symbol
Dmel\AGO1-RC
Species
D. melanogaster
Annotation Symbol
CG6671-RC
FlyBase ID
FBtr0087612
Feature type
Associated gene
Evidence Rank
Length (nt)
7528
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 188 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    cDNA Clones, End Sequence Only (ESTs)
    Contained within the annotated transcript, internally consistent
    End(s) extend beyond the annotated transcript, internally consistent
    Sequence
    CAAATAAGTTGTGTTTGTGCAAAACTCGCGCGTTCGCAATTTTCCGAAGCTGACTCTCAATTCTCATACATAACGATCTC
    AAGCGATCTCCGCCAGGCGAATCAAACCCGGATATATCCAGATCTGCACGCTGGAAAAGTAACGTCCGCAACGGTTTAAA
    TCCAGTCGAGACGCAAACCCCACTCAACTCCTTAATGAGTTCCCCTCCATTAAACGGAATTCACCAAAAAAAACGATTGA
    TTTGCCGCTGATAAAGCTGATAAAAGCGCACACACACACCAAAGTCAGCTGCAATTTTGCGATAAGGAGCAGCGACGCCG
    CCTCAAACTGACGCCGACACCGACTAAAATGTCCACGGAGCGTGAGCTGGCTCCCGGTGGGCCAGCTCAGCTCCATCCGC
    ACACGCTGCCGCTGACTTTTCCGGATCTCCAGATGACCTCCACCGTGGGCATCATTGGGAAAGTCTACGAGTCACAGTGG
    ACCCCCTCGCCCACTCGGCCTCAGAGTCCCTCTCAGGCGCAGACTAGCTTCGACACGCTCACATCACCACCAGCGCCCGG
    CTCGTCGGTCAATCCCACCGCCGTCACCAGCCCAAGTGCCCAGAATGTGGCCGCTGGTGGAGCAACTGTGGCCGGTGCAG
    CAGCAACTGCCGCCCAGGTGGCCTCCGCCTTGGGTGCCACCACCGGCAGCGTGACGCCAGCAATTGCCACCGCAACGCCA
    GCCACGCAGCCGGATATGCCCGTCTTTACGTGTCCACGACGCCCGAATCTCGGACGAGAGGGTCGCCCGATTGTGCTGCG
    CGCCAATCACTTCCAGGTGACAATGCCGCGTGGCTATGTGCATCACTATGACATCAATATACAGCCGGACAAGTGTCCGC
    GAAAGGTGAACCGTGAGATTATCGAGACTATGGTGCATGCCTATAGCAAGATCTTCGGAGTGCTCAAGCCGGTGTTCGAT
    GGTCGCAACAATCTGTATACCCGCGATCCCCTGCCCATTGGCAACGAGCGTCTAGAGCTGGAGGTTACTCTACCCGGCGA
    GGGCAAAGATCGAATCTTTCGCGTGACGATCAAGTGGCAGGCTCAGGTCTCGCTCTTCAATTTGGAGGAAGCTCTCGAAG
    GCCGCACGCGGCAGATACCCTATGATGCCATTTTGGCGCTCGATGTGGTCATGCGCCATCTGCCCAGCATGACGTACACG
    CCAGTGGGACGTAGCTTCTTCAGTTCCCCGGAGGGTTACTACCATCCCCTGGGTGGTGGACGCGAGGTTTGGTTCGGTTT
    CCATCAGAGCGTAAGGCCCTCGCAGTGGAAGATGATGCTCAATATCGATGTCTCGGCCACCGCTTTCTACAAGGCTCAAC
    CAGTCATTGACTTCATGTGCGAGGTGCTGGACATTCGCGACATCAACGAGCAGCGCAAACCGCTCACCGATTCGCAGCGC
    GTCAAGTTCACGAAGGAGATCAAGGGTTTGAAGATCGAGATCACCCACTGCGGCCAGATGCGTCGCAAGTATCGTGTGTG
    CAACGTCACTCGCCGCCCCGCTCAGATGCAATCATTCCCACTGCAGCTGGAGAACGGACAGACCGTAGAGTGCACCGTGG
    CCAAGTACTTCCTGGACAAGTACCGCATGAAATTGCGCTACCCGCACTTGCCCTGCCTGCAGGTTGGCCAAGAGCACAAG
    CACACTTACCTGCCTCTAGAGGTGTGCAACATTGTGGCCGGACAGCGGTGCATTAAAAAGCTGACCGATATGCAGACGTC
    GACCATGATCAAGGCCACAGCTCGTTCAGCTCCGGATCGTGAGCGTGAGATTAACAACTTGGTAAAGCGCGCCGACTTCA
    ACAACGATTCGTATGTGCAAGAGTTTGGCCTGACCATCTCCAATTCGATGATGGAGGTACGAGGACGCGTCTTGCCTCCT
    CCCAAGCTTCAGTATGGGGGACGTGTGTCTACCGGCCTCACCGGCCAGCAGCTGTTCCCGCCACAGAACAAGGTGAGCTT
    GGCCTCGCCCAACCAGGGTGTATGGGATATGCGAGGCAAGCAGTTCTTCACTGGCGTCGAGATCCGCATCTGGGCCATCG
    CCTGTTTTGCCCCACAGCGCACGGTGCGCGAGGATGCGCTGCGTAATTTCACCCAGCAGCTGCAGAAGATCTCAAACGAT
    GCAGGCATGCCGATAATTGGACAGCCGTGCTTCTGTAAGTACGCCACCGGGCCGGATCAAGTGGAACCCATGTTCCGTTA
    CCTGAAGATCACCTTCCCCGGCCTGCAACTCGTCGTGGTTGTGCTGCCCGGCAAGACTCCAGTATACGCCGAGGTGAAGC
    GTGTAGGTGACACCGTTCTGGGTATGGCCACCCAGTGTGTGCAGGCCAAGAACGTGAACAAGACATCGCCACAGACGCTC
    TCTAATCTGTGTCTGAAGATCAACGTCAAGTTGGGCGGCATCAATTCAATTCTGGTCCCCTCCATTCGGCCAAAGGTCTT
    CAATGAGCCGGTCATCTTTTTGGGTGCCGATGTGACACACCCACCAGCTGGCGACAACAAGAAACCATCGATTGCCGCCG
    TCGTGGGCTCCATGGATGCCCATCCATCGCGGTATGCCGCCACCGTTCGCGTACAGCAGCACCGACAGGAGATCATCCAG
    GAGCTGAGCAGCATGGTGCGCGAGCTGTTGATCATGTTCTACAAGTCGACGGGCGGCTACAAGCCCCACCGCATCATACT
    CTATCGTGACGGAGTCTCCGAGGGACAATTCCCACATGTCCTGCAACACGAATTGACCGCCATTCGCGAGGCCTGCATTA
    AGCTAGAGCCAGAGTATCGGCCGGGCATCACATTCATTGTGGTGCAGAAGCGCCATCACACTCGACTCTTCTGCGCGGAG
    AAGAAGGAGCAGAGCGGCAAATCGGGCAATATTCCCGCAGGCACCACCGTCGATGTGGGCATCACACATCCCACCGAATT
    TGATTTCTATCTATGCAGCCATCAGGGCATCCAGGGCACCAGTCGCCCCTCGCACTACCACGTTCTGTGGGACGACAATC
    ACTTTGACTCGGACGAGCTGCAGTGCCTCACGTATCAGCTATGCCATACGTACGTGCGCTGCACCCGATCCGTCAGTATA
    CCGGCGCCAGCCTACTACGCCCATTTAGTGGCCTTCCGTGCCAGATATCATCTGGTGGAGAAGGAGCACGATTCGGGCGA
    GGGTTCGCACCAGAGCGGCTGCTCAGAGGATCGTACGCCAGGTGCCATGGCCAGGGCCATCACTGTGCACGCGGATACCA
    AGAAGGTCATGTACTTTGCCTAAAAAGTATCGCCCCTCCCCAATACCAACACCAAAAAGCTAAAGAATACAAAATCAGTT
    TCGAATTTCGATTCGAATAAGCAACTCCCCACTTCCTTCCCTCAAATCAGAAAGCGGAAAGCGGATGAAAGCCAAGCATA
    GAAGTTTAGAATTAAGTTACGTTTTACGTTGAGAGAGCGCGGATGGGTGGAAAAACCAATCAGAATACGAAGATCTTGCA
    TGCATTAGTTACGTACACGTACATATATAGTAAGCAGAGTAATGAAAATCCCACAAACACCATCCACACACTCACTCATC
    CACACACACACAAATCAGATAGCCACACAGTGAGAAATGATAACTAATCGAATGTCAGGCACAAGTTTGCGAAATCAAAG
    AAATGTGAGAATTCTCAAAAACAAGCGTAGCAAACAAATTGAAAGCAAATAGGAAATCAACTAAAGGGAACAAAAACTAC
    GACAGCAACACCAACCAACACCAGAAAAACAAAACAAATTAAAACATAACCAAAATGGAAGTGAAATTACGTGAAAAGCG
    AGCGTCATCAGCACGAGAGAGAGAGACAAGTTTTGTAATAGAAATTACGATTAAATTGTACAATATATTTTTACACGATA
    CGAAATGAAGACATGATGAATGATAATGAATGAATGCATACAACCAAAGGTTTTTAGTATACAAAATGAATACGTTGCTG
    ATCGACTCACACAGCAAACACCACATGAACACCAACCACTCGGATTCTCTGTACTGTGAACGAAGACCACCACCAAAATA
    TAAACAAAAACCACAAGCGACATTAAAGCGACAAGCATTGAAAGAGTGTGTAGACACAACTTAGCATGTACTAATGAATT
    ACTTCAATACTTCAACTAGGGCGCTGACAAAACCAAGCAAGAACATTTAATAGTTTGTAAGTTGGGCTCTACCAAAAACC
    GAACACAAAATGAGAGAGAGAGAGAGAGAGAAAAATGCAAGCAAGGCCAGATAAGTTAAGTGGGCAATGAATAACGAGAA
    CTGCAATTTCAACAAGGGACAAACTTTTGGTCAAAACAATAGCTATACTTATAGAGCAGAGCCTAATATATACATACATA
    ATTAGAATCTAAAACTAAAATTTAAAGTTTTTACGAAACGATAACCAAGCGGATGGAGCTGTTGTAACAATGTAGATTAC
    TTAAATTCAAAAGTGCAAATAACACGGTAGCAGACACGTTACGTTGGCAGTGCTGATATTTTATGTTAGTCCTTAGTTTA
    CCCTCTTTTATGCACCACACCACCACACAATCAGACTCCGAACTTCTTCAACCCTCCTCGAGTCCAAGGCATATCACTCA
    ATGTCCTCTTATTTATGTACCTCCTACAATAAGCCTTATGATATATTTAGTTGTACCTTATATATATATATATATATTTT
    TTAAAACGAATGCCTAACGAAATTTGTTGATTTCTTCATGTTGATGCTTCGAATTGGCTTCTTCGCTGCTTTTCGTTGTA
    ATAATTTCGTATTAATTAACTTTAGATCAAAGTGGTGTACGGGTAATAATAAACAAGGTAACTCTTCTCCACCGTCCGCC
    GGAGGGAGGTGGCAACAACATTTCAATATTTTACAAAGTAGTTTTAGTTTCGCCAAAATCAACAAGCAAACAAACAATAT
    CAATATCAATATGAAACGTATGCTTAGTAATTGTACTATATCGAGGACACAGTTCAAGTTAACATTATAATGAGTTGTTA
    TTTATGCGGCGCGGGCGACGACGTTCTATCCACTCGGAATCGCCCGGGCCAAACCTAATTTATAATTGTATACATCCTTC
    TTCACAGAACCTTTAATTTAGATTTAGTTTCCAAGTTTGCAAGCTGTTTTGCCAATCGTACATTATGTGAGCATTATAAA
    ATACATAATATATATAAATCTATATGCTTATATTTAATCATTTACTGCACTTACAAATTAGTTGGTAATCCTCAAGAATA
    TATGTATAAAGAAAAAAAGGGAACAGAACGGAAGAAAGGAGGTCGCACGCGGTCCCTCAAAATGTTGAATCGAACTTATA
    GAAATCTCTTTGGATTTGAAATCATATACAAACTGGTGGAACTTCACGAATGATTTCAAATCCCTTGATATTTCAGTGGT
    GGCAAAAAATTTTTAAATCTGCATTCTCAATGCCTGTTTTTAAACTTCTCGATGTTTATCATTTAGTCAACTACTTCGAG
    TGCAATGATATCTTTTGCAGAAATTTTAAAACCAGAGTTAATATTTAAAAGTCTTCAAATAAAGTTTTTTTTTTGTCTAA
    ATTTTGACTAGTCCTTCCAACGAGGCTCAACATAGCTGATATTAATAGCTTATTAATTAATTAATATTAATTGGTAATGC
    GTTTAAATGCGATTAACATTTTGTGGGGCTGTGCAATTAATTGTGTGGGCGTATTTGTGGACTTATTCATTTTCCATTTT
    TTTTTCTAATAACGTTTCTACACAAGGGATTAAAATTTTAAACTTATGTCTTAATTTTTACTTAAAGCAACCCGATGCAA
    AAAAAAACAAACAAACAAAAACCAACAAAAAAACGAATCAAACAATTTTAGTTTTAAGAAAAAAAAAAACAAGAAAACGA
    AAACGAAACAATGCAAAGGAGTTCGCGATTCGGGGCTCGATTTTTGAGATCGGCCAGAAAGAACCAACATTTACATTATA
    TATTCACTTAGTTTAAGCTGAAGCTGAAATGTGTGCCGACAATGAATGCATCTCGTAGTTGTAAAATGAGCGAAATATTC
    AACAATAATTTACTTTACCACACAATACATGAGAAAGTCCAAAGCTTTAACTTACTCGCAAGATGAATGAAGCGGAAATA
    TCGGTGGGAAAACCCTTATCACTAATGAAAATGCCAATAACAAGCTGCTATCTCCTCCCATCCAAGAAAAATGGGCTGTA
    ACAGTTGTCCCTATATACACGCGTAAAACTTATACATATATAGTAAAGCTGGATAACTCCGATTTTCCCAAGAACTCAAG
    AAAACTACTCACACACGCTACAATTTCAATGGTTTCTTCAGTGTCGTGCAGCTAAGTAAAAGGAAAACAAGTTGGAGGAG
    AAGATTGAAGATCGTGGATGGCCTTAGATATCATTTCCAAACTATGTTCTGCTCAGAGGCAAGGCCCAAATAAAAAGACA
    AAAAGCCGGGATATCCAAATGGGAACTTACATTTTTATCTGTCAAAATTCAATTGAGCTTTAAACTAAAGATAGATCGAG
    AAAAAACGAAAATAAAAAAAAAACAAAAAAAAAATGGAAGTAAAAACTTGAACAAAAAAAAGAAGAGAAGAGTAAGAAAT
    ACAGAAAGGAATCGCATTGTTTCTACATATTACTTATAAATGTGCCGTTTATAGATGTCTACAATTATATACAACAAATA
    TAGATATATACCTAGATATATAATCAGATCGAAATCGAAGCTAGAACAGCAATTTGCACAACTCTTCCTAAAGGAAATAA
    AAAGATAAAAATACAAATCTAAATCTAACTAACGATTAAATTACATATATGCCACAATTACCGAGATTTCAAGAAGTGAC
    GGACTAACTCCAAGCAATTAAAACGTTATATTTGAAATAACTTATGAACTTATGATACCATATATGTATGTGTGTACTCT
    ATACTCTTCCAACTAGACCCAGAGTCCCACTCGAACCCGGACCACATGCGCGATCCACATAGCCATTAGCCCACAAACAC
    TCAATCCACACAATACACACAATCCACACTCGACTTAGTGTTCCAAATGCGCATCGGATCAGATCGGATAACGAACCCCT
    TAGCTGAAATTCGACTAGCAAAATCAATACGTTAGTAACACTTATTCGTGCGTTAAGATTAGGGAGATCATCTGGTACAT
    ACCTTACTTTAAAAATCAACCAAAATGCCGGGTAATTAATCAATAAAATACATATTATTAGTTCTAATCTAAGAGGAGTA
    AACAAAAACAAAACAAAAACAAAAGGAAAACAAAAATACATCAACATTATGAATAAAGAAAAATAAGCAACGTGAGCAAC
    GTAATATGGGAAATCTGTAACTTTGGTGATCTTTTTAAATGTTATTAGTAAAAGAAGGCAAAACAAAATCAAGTTTAATG
    ACGAATACAAATCAAACCAGTTTTAAATGTGACTTAAATTACGACGTAAACGACATTTTTCCACAACATTATATGTGTAA
    ACAAGACG
    
    Other Products of this Gene
    Other Transcripts
    Name
    FlyBase ID
    Length (nt)
    FBtr0087613
    3481
    FBtr0087614
    5738
    FBtr0305592
    7888
    Polypeptides
    Derived from THIS transcript
    Name
    FlyBase ID
    Length (aa)
    FBpp0086738
    984
    Derived from OTHER transcripts
    Name
    FlyBase ID
    Length (aa)
    FBpp0086739
    984
    FBpp0086740
    950
    FBpp0294043
    984
    Comments

    Transcript terminates at site supported by polyadenylated cDNA.

    External Crossreferences and Linkouts ( 1 )
    Crossreferences
    RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
    Synonyms and Secondary IDs (2)
    Reported As
    Symbol Synonym
    CG6671-RC
    Secondary FlyBase IDs
      References (2)