Open Close
General Information
Symbol
Dmel\AGO1-RA
Species
D. melanogaster
Annotation Symbol
CG6671-RA
FlyBase ID
FBtr0087613
Feature type
Associated gene
Evidence Rank
Length (nt)
3481
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 35 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
      cDNA Clones, End Sequence Only (ESTs)
      End(s) extend beyond the annotated transcript, internally consistent
      Sequence
      ACAGTGCGGAGTGTTTGTTACATGTTAGAGCGTATATATATTTTGAAAAGAGCAGCGACGCCGCCTCAAACTGACGCCGA
      CACCGACTAAAATGTCCACGGAGCGTGAGCTGGCTCCCGGTGGGCCAGCTCAGCTCCATCCGCACACGCTGCCGCTGACT
      TTTCCGGATCTCCAGATGACCTCCACCGTGGGCATCATTGGGAAAGTCTACGAGTCACAGTGGACCCCCTCGCCCACTCG
      GCCTCAGAGTCCCTCTCAGGCGCAGACTAGCTTCGACACGCTCACATCACCACCAGCGCCCGGCTCGTCGGTCAATCCCA
      CCGCCGTCACCAGCCCAAGTGCCCAGAATGTGGCCGCTGGTGGAGCAACTGTGGCCGGTGCAGCAGCAACTGCCGCCCAG
      GTGGCCTCCGCCTTGGGTGCCACCACCGGCAGCGTGACGCCAGCAATTGCCACCGCAACGCCAGCCACGCAGCCGGATAT
      GCCCGTCTTTACGTGTCCACGACGCCCGAATCTCGGACGAGAGGGTCGCCCGATTGTGCTGCGCGCCAATCACTTCCAGG
      TGACAATGCCGCGTGGCTATGTGCATCACTATGACATCAATATACAGCCGGACAAGTGTCCGCGAAAGGTGAACCGTGAG
      ATTATCGAGACTATGGTGCATGCCTATAGCAAGATCTTCGGAGTGCTCAAGCCGGTGTTCGATGGTCGCAACAATCTGTA
      TACCCGCGATCCCCTGCCCATTGGCAACGAGCGTCTAGAGCTGGAGGTTACTCTACCCGGCGAGGGCAAAGATCGAATCT
      TTCGCGTGACGATCAAGTGGCAGGCTCAGGTCTCGCTCTTCAATTTGGAGGAAGCTCTCGAAGGCCGCACGCGGCAGATA
      CCCTATGATGCCATTTTGGCGCTCGATGTGGTCATGCGCCATCTGCCCAGCATGACGTACACGCCAGTGGGACGTAGCTT
      CTTCAGTTCCCCGGAGGGTTACTACCATCCCCTGGGTGGTGGACGCGAGGTTTGGTTCGGTTTCCATCAGAGCGTAAGGC
      CCTCGCAGTGGAAGATGATGCTCAATATCGATGTCTCGGCCACCGCTTTCTACAAGGCTCAACCAGTCATTGACTTCATG
      TGCGAGGTGCTGGACATTCGCGACATCAACGAGCAGCGCAAACCGCTCACCGATTCGCAGCGCGTCAAGTTCACGAAGGA
      GATCAAGGGTTTGAAGATCGAGATCACCCACTGCGGCCAGATGCGTCGCAAGTATCGTGTGTGCAACGTCACTCGCCGCC
      CCGCTCAGATGCAATCATTCCCACTGCAGCTGGAGAACGGACAGACCGTAGAGTGCACCGTGGCCAAGTACTTCCTGGAC
      AAGTACCGCATGAAATTGCGCTACCCGCACTTGCCCTGCCTGCAGGTTGGCCAAGAGCACAAGCACACTTACCTGCCTCT
      AGAGGTGTGCAACATTGTGGCCGGACAGCGGTGCATTAAAAAGCTGACCGATATGCAGACGTCGACCATGATCAAGGCCA
      CAGCTCGTTCAGCTCCGGATCGTGAGCGTGAGATTAACAACTTGGTAAAGCGCGCCGACTTCAACAACGATTCGTATGTG
      CAAGAGTTTGGCCTGACCATCTCCAATTCGATGATGGAGGTACGAGGACGCGTCTTGCCTCCTCCCAAGCTTCAGTATGG
      GGGACGTGTGTCTACCGGCCTCACCGGCCAGCAGCTGTTCCCGCCACAGAACAAGGTGAGCTTGGCCTCGCCCAACCAGG
      GTGTATGGGATATGCGAGGCAAGCAGTTCTTCACTGGCGTCGAGATCCGCATCTGGGCCATCGCCTGTTTTGCCCCACAG
      CGCACGGTGCGCGAGGATGCGCTGCGTAATTTCACCCAGCAGCTGCAGAAGATCTCAAACGATGCAGGCATGCCGATAAT
      TGGACAGCCGTGCTTCTGTAAGTACGCCACCGGGCCGGATCAAGTGGAACCCATGTTCCGTTACCTGAAGATCACCTTCC
      CCGGCCTGCAACTCGTCGTGGTTGTGCTGCCCGGCAAGACTCCAGTATACGCCGAGGTGAAGCGTGTAGGTGACACCGTT
      CTGGGTATGGCCACCCAGTGTGTGCAGGCCAAGAACGTGAACAAGACATCGCCACAGACGCTCTCTAATCTGTGTCTGAA
      GATCAACGTCAAGTTGGGCGGCATCAATTCAATTCTGGTCCCCTCCATTCGGCCAAAGGTCTTCAATGAGCCGGTCATCT
      TTTTGGGTGCCGATGTGACACACCCACCAGCTGGCGACAACAAGAAACCATCGATTGCCGCCGTCGTGGGCTCCATGGAT
      GCCCATCCATCGCGGTATGCCGCCACCGTTCGCGTACAGCAGCACCGACAGGAGATCATCCAGGAGCTGAGCAGCATGGT
      GCGCGAGCTGTTGATCATGTTCTACAAGTCGACGGGCGGCTACAAGCCCCACCGCATCATACTCTATCGTGACGGAGTCT
      CCGAGGGACAATTCCCACATGTCCTGCAACACGAATTGACCGCCATTCGCGAGGCCTGCATTAAGCTAGAGCCAGAGTAT
      CGGCCGGGCATCACATTCATTGTGGTGCAGAAGCGCCATCACACTCGACTCTTCTGCGCGGAGAAGAAGGAGCAGAGCGG
      CAAATCGGGCAATATTCCCGCAGGCACCACCGTCGATGTGGGCATCACACATCCCACCGAATTTGATTTCTATCTATGCA
      GCCATCAGGGCATCCAGGGCACCAGTCGCCCCTCGCACTACCACGTTCTGTGGGACGACAATCACTTTGACTCGGACGAG
      CTGCAGTGCCTCACGTATCAGCTATGCCATACGTACGTGCGCTGCACCCGATCCGTCAGTATACCGGCGCCAGCCTACTA
      CGCCCATTTAGTGGCCTTCCGTGCCAGATATCATCTGGTGGAGAAGGAGCACGATTCGGGCGAGGGTTCGCACCAGAGCG
      GCTGCTCAGAGGATCGTACGCCAGGTGCCATGGCCAGGGCCATCACTGTGCACGCGGATACCAAGAAGGTCATGTACTTT
      GCCTAAAAAGTATCGCCCCTCCCCAATACCAACACCAAAAAGCTAAAGAATACAAAATCAGTTTCGAATTTCGATTCGAA
      TAAGCAACTCCCCACTTCCTTCCCTCAAATCAGAAAGCGGAAAGCGGATGAAAGCCAAGCATAGAAGTTTAGAATTAAGT
      TACGTTTTACGTTGAGAGAGCGCGGATGGGTGGAAAAACCAATCAGAATACGAAGATCTTGCATGCATTAGTTACGTACA
      CGTACATATATAGTAAGCAGAGTAATGAAAATCCCACAAACACCATCCACACACTCACTCATCCACACACACACAAATCA
      GATAGCCACACAGTGAGAAATGATAACTAATCGAATGTCAGGCACAAGTTTGCGAAATCAAAGAAATGTGAGAATTCTCA
      AAAACAAGCGTAGCAAACAAATTGAAAGCAAATAGGAAATC
      
      Other Products of this Gene
      Other Transcripts
      Name
      FlyBase ID
      Length (nt)
      FBtr0087614
      5738
      FBtr0087612
      7528
      FBtr0305592
      7888
      Polypeptides
      Derived from THIS transcript
      Name
      FlyBase ID
      Length (aa)
      FBpp0086739
      984
      Derived from OTHER transcripts
      Name
      FlyBase ID
      Length (aa)
      FBpp0086740
      950
      FBpp0086738
      984
      FBpp0294043
      984
      Comments

      Transcript terminates at site supported by polyadenylated cDNA.

      External Crossreferences and Linkouts ( 1 )
      Crossreferences
      RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
      Synonyms and Secondary IDs (2)
      Reported As
      Symbol Synonym
      CG6671-RA
      Secondary FlyBase IDs
        References (2)