Open Close
General Information
Symbol
Dmel\AGO1-RB
Species
D. melanogaster
Annotation Symbol
CG6671-RB
FlyBase ID
FBtr0087614
Feature type
Associated gene
Evidence Rank
Length (nt)
5738
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 130 )
Sequence
GCTCACACGTCGCGAGTACAATTTTTGTGTGGACGTCCAGTGTGTGGCTGCTGTGGGAAAAGCTGAAGAAAATTGCATTT
TTTGCATAATGCGCGGCGTGAAAAGCTAACAAAATGTGATAAGCAAAAGGCTGAAATCAAAAACAAAAAAAAAAACAAAA
TAATTAGTAGAAAACCAAAAGCAAAGGCAACAACAAATACAACAACAACAAAGAAACAAACAATCAATTACATTTTACAC
CAAAACACGAAAAGCAAACACGAGCCAACATTTTTTACATTAATTATTTTTCTTAAACCAAAACCTAACTTAGTGCAAAA
ACATGTATCCAGTTGGACAACAGTCACAGTGGACCCCCTCGCCCACTCGGCCTCAGAGTCCCTCTCAGGCGCAGACTAGC
TTCGACACGCTCACATCACCACCAGCGCCCGGCTCGTCGGTCAATCCCACCGCCGTCACCAGCCCAAGTGCCCAGAATGT
GGCCGCTGGTGGAGCAACTGTGGCCGGTGCAGCAGCAACTGCCGCCCAGGTGGCCTCCGCCTTGGGTGCCACCACCGGCA
GCGTGACGCCAGCAATTGCCACCGCAACGCCAGCCACGCAGCCGGATATGCCCGTCTTTACGTGTCCACGACGCCCGAAT
CTCGGACGAGAGGGTCGCCCGATTGTGCTGCGCGCCAATCACTTCCAGGTGACAATGCCGCGTGGCTATGTGCATCACTA
TGACATCAATATACAGCCGGACAAGTGTCCGCGAAAGGTGAACCGTGAGATTATCGAGACTATGGTGCATGCCTATAGCA
AGATCTTCGGAGTGCTCAAGCCGGTGTTCGATGGTCGCAACAATCTGTATACCCGCGATCCCCTGCCCATTGGCAACGAG
CGTCTAGAGCTGGAGGTTACTCTACCCGGCGAGGGCAAAGATCGAATCTTTCGCGTGACGATCAAGTGGCAGGCTCAGGT
CTCGCTCTTCAATTTGGAGGAAGCTCTCGAAGGCCGCACGCGGCAGATACCCTATGATGCCATTTTGGCGCTCGATGTGG
TCATGCGCCATCTGCCCAGCATGACGTACACGCCAGTGGGACGTAGCTTCTTCAGTTCCCCGGAGGGTTACTACCATCCC
CTGGGTGGTGGACGCGAGGTTTGGTTCGGTTTCCATCAGAGCGTAAGGCCCTCGCAGTGGAAGATGATGCTCAATATCGA
TGTCTCGGCCACCGCTTTCTACAAGGCTCAACCAGTCATTGACTTCATGTGCGAGGTGCTGGACATTCGCGACATCAACG
AGCAGCGCAAACCGCTCACCGATTCGCAGCGCGTCAAGTTCACGAAGGAGATCAAGGGTTTGAAGATCGAGATCACCCAC
TGCGGCCAGATGCGTCGCAAGTATCGTGTGTGCAACGTCACTCGCCGCCCCGCTCAGATGCAATCATTCCCACTGCAGCT
GGAGAACGGACAGACCGTAGAGTGCACCGTGGCCAAGTACTTCCTGGACAAGTACCGCATGAAATTGCGCTACCCGCACT
TGCCCTGCCTGCAGGTTGGCCAAGAGCACAAGCACACTTACCTGCCTCTAGAGGTGTGCAACATTGTGGCCGGACAGCGG
TGCATTAAAAAGCTGACCGATATGCAGACGTCGACCATGATCAAGGCCACAGCTCGTTCAGCTCCGGATCGTGAGCGTGA
GATTAACAACTTGGTAAAGCGCGCCGACTTCAACAACGATTCGTATGTGCAAGAGTTTGGCCTGACCATCTCCAATTCGA
TGATGGAGGTACGAGGACGCGTCTTGCCTCCTCCCAAGCTTCAGTATGGGGGACGTGTGTCTACCGGCCTCACCGGCCAG
CAGCTGTTCCCGCCACAGAACAAGGTGAGCTTGGCCTCGCCCAACCAGGGTGTATGGGATATGCGAGGCAAGCAGTTCTT
CACTGGCGTCGAGATCCGCATCTGGGCCATCGCCTGTTTTGCCCCACAGCGCACGGTGCGCGAGGATGCGCTGCGTAATT
TCACCCAGCAGCTGCAGAAGATCTCAAACGATGCAGGCATGCCGATAATTGGACAGCCGTGCTTCTGTAAGTACGCCACC
GGGCCGGATCAAGTGGAACCCATGTTCCGTTACCTGAAGATCACCTTCCCCGGCCTGCAACTCGTCGTGGTTGTGCTGCC
CGGCAAGACTCCAGTATACGCCGAGGTGAAGCGTGTAGGTGACACCGTTCTGGGTATGGCCACCCAGTGTGTGCAGGCCA
AGAACGTGAACAAGACATCGCCACAGACGCTCTCTAATCTGTGTCTGAAGATCAACGTCAAGTTGGGCGGCATCAATTCA
ATTCTGGTCCCCTCCATTCGGCCAAAGGTCTTCAATGAGCCGGTCATCTTTTTGGGTGCCGATGTGACACACCCACCAGC
TGGCGACAACAAGAAACCATCGATTGCCGCCGTCGTGGGCTCCATGGATGCCCATCCATCGCGGTATGCCGCCACCGTTC
GCGTACAGCAGCACCGACAGGAGATCATCCAGGAGCTGAGCAGCATGGTGCGCGAGCTGTTGATCATGTTCTACAAGTCG
ACGGGCGGCTACAAGCCCCACCGCATCATACTCTATCGTGACGGAGTCTCCGAGGGACAATTCCCACATGTCCTGCAACA
CGAATTGACCGCCATTCGCGAGGCCTGCATTAAGCTAGAGCCAGAGTATCGGCCGGGCATCACATTCATTGTGGTGCAGA
AGCGCCATCACACTCGACTCTTCTGCGCGGAGAAGAAGGAGCAGAGCGGCAAATCGGGCAATATTCCCGCAGGCACCACC
GTCGATGTGGGCATCACACATCCCACCGAATTTGATTTCTATCTATGCAGCCATCAGGGCATCCAGGGCACCAGTCGCCC
CTCGCACTACCACGTTCTGTGGGACGACAATCACTTTGACTCGGACGAGCTGCAGTGCCTCACGTATCAGCTATGCCATA
CGTACGTGCGCTGCACCCGATCCGTCAGTATACCGGCGCCAGCCTACTACGCCCATTTAGTGGCCTTCCGTGCCAGATAT
CATCTGGTGGAGAAGGAGCACGATTCGGGCGAGGGTTCGCACCAGAGCGGCTGCTCAGAGGATCGTACGCCAGGTGCCAT
GGCCAGGGCCATCACTGTGCACGCGGATACCAAGAAGGTCATGTACTTTGCCTAAAAAGTATCGCCCCTCCCCAATACCA
ACACCAAAAAGCTAAAGAATACAAAATCAGTTTCGAATTTCGATTCGAATAAGCAACTCCCCACTTCCTTCCCTCAAATC
AGAAAGCGGAAAGCGGATGAAAGCCAAGCATAGAAGTTTAGAATTAAGTTACGTTTTACGTTGAGAGAGCGCGGATGGGT
GGAAAAACCAATCAGAATACGAAGATCTTGCATGCATTAGTTACGTACACGTACATATATAGTAAGCAGAGTAATGAAAA
TCCCACAAACACCATCCACACACTCACTCATCCACACACACACAAATCAGATAGCCACACAGTGAGAAATGATAACTAAT
CGAATGTCAGGCACAAGTTTGCGAAATCAAAGAAATGTGAGAATTCTCAAAAACAAGCGTAGCAAACAAATTGAAAGCAA
ATAGGAAATCAACTAAAGGGAACAAAAACTACGACAGCAACACCAACCAACACCAGAAAAACAAAACAAATTAAAACATA
ACCAAAATGGAAGTGAAATTACGTGAAAAGCGAGCGTCATCAGCACGAGAGAGAGAGACAAGTTTTGTAATAGAAATTAC
GATTAAATTGTACAATATATTTTTACACGATACGAAATGAAGACATGATGAATGATAATGAATGAATGCATACAACCAAA
GGTTTTTAGTATACAAAATGAATACGTTGCTGATCGACTCACACAGCAAACACCACATGAACACCAACCACTCGGATTCT
CTGTACTGTGAACGAAGACCACCACCAAAATATAAACAAAAACCACAAGCGACATTAAAGCGACAAGCATTGAAAGAGTG
TGTAGACACAACTTAGCATGTACTAATGAATTACTTCAATACTTCAACTAGGGCGCTGACAAAACCAAGCAAGAACATTT
AATAGTTTGTAAGTTGGGCTCTACCAAAAACCGAACACAAAATGAGAGAGAGAGAGAGAGAGAAAAATGCAAGCAAGGCC
AGATAAGTTAAGTGGGCAATGAATAACGAGAACTGCAATTTCAACAAGGGACAAACTTTTGGTCAAAACAATAGCTATAC
TTATAGAGCAGAGCCTAATATATACATACATAATTAGAATCTAAAACTAAAATTTAAAGTTTTTACGAAACGATAACCAA
GCGGATGGAGCTGTTGTAACAATGTAGATTACTTAAATTCAAAAGTGCAAATAACACGGTAGCAGACACGTTACGTTGGC
AGTGCTGATATTTTATGTTAGTCCTTAGTTTACCCTCTTTTATGCACCACACCACCACACAATCAGACTCCGAACTTCTT
CAACCCTCCTCGAGTCCAAGGCATATCACTCAATGTCCTCTTATTTATGTACCTCCTACAATAAGCCTTATGATATATTT
AGTTGTACCTTATATATATATATATATATTTTTTAAAACGAATGCCTAACGAAATTTGTTGATTTCTTCATGTTGATGCT
TCGAATTGGCTTCTTCGCTGCTTTTCGTTGTAATAATTTCGTATTAATTAACTTTAGATCAAAGTGGTGTACGGGTAATA
ATAAACAAGGTAACTCTTCTCCACCGTCCGCCGGAGGGAGGTGGCAACAACATTTCAATATTTTACAAAGTAGTTTTAGT
TTCGCCAAAATCAACAAGCAAACAAACAATATCAATATCAATATGAAACGTATGCTTAGTAATTGTACTATATCGAGGAC
ACAGTTCAAGTTAACATTATAATGAGTTGTTATTTATGCGGCGCGGGCGACGACGTTCTATCCACTCGGAATCGCCCGGG
CCAAACCTAATTTATAATTGTATACATCCTTCTTCACAGAACCTTTAATTTAGATTTAGTTTCCAAGTTTGCAAGCTGTT
TTGCCAATCGTACATTATGTGAGCATTATAAAATACATAATATATATAAATCTATATGCTTATATTTAATCATTTACTGC
ACTTACAAATTAGTTGGTAATCCTCAAGAATATATGTATAAAGAAAAAAAGGGAACAGAACGGAAGAAAGGAGGTCGCAC
GCGGTCCCTCAAAATGTTGAATCGAACTTATAGAAATCTCTTTGGATTTGAAATCATATACAAACTGGTGGAACTTCACG
AATGATTTCAAATCCCTTGATATTTCAGTGGTGGCAAAAAATTTTTAAATCTGCATTCTCAATGCCTGTTTTTAAACTTC
TCGATGTTTATCATTTAGTCAACTACTTCGAGTGCAATGATATCTTTTGCAGAAATTTTAAAACCAGAGTTAATATTTAA
AAGTCTTCAAATAAAGTTTTTTTTTTGTCTAAATTTTGACTAGTCCTTCCAACGAGGCTCAACATAGCTGATATTAATAG
CTTATTAATTAATTAATATTAATTGGTAATGCGTTTAAATGCGATTAACATTTTGTGGGGCTGTGCAATTAATTGTGTGG
GCGTATTTGTGGACTTATTCATTTTCCATTTTTTTTTCTAATAACGTTTCTACACAAGGGATTAAAATTTTAAACTTATG
TCTTAATTTTTACTTAAAGCAACCCGATGCAAAAAAAAACAAACAAACAAAAACCAAC
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0087613
3481
FBtr0087612
7528
FBtr0305592
7888
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0086740
950
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0086739
984
FBpp0086738
984
FBpp0294043
984
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG6671-RB
Secondary FlyBase IDs
    References (2)