Open Close
General Information
Symbol
Dmel\CaMKII-RJ
Species
D. melanogaster
Annotation Symbol
CG18069-RJ
FlyBase ID
FBtr0300379
Feature type
Associated gene
Evidence Rank
Length (nt)
1845
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 116 )
Sequence
CTATCGAATGTCATGTCATCTCTAGGCAACAACAAGAAAACAAGAAATAAAACTCCTGAAAAGTGAAATCTGTAGAGCAG
TTGAAGATCTTTAGTCGCAATAGATTTTCTTAAGTGTGCCATCGCGATGGCTGCACCAGCAGCCTGTACGCGTTTTTCGG
ACAATTACGACATCAAAGAAGAGTTGGGAAAAGGAGCATTCTCAATTGTGAAAAGATGTGTCCAAAAGTCAACTGGCTTT
GAATTTGCTGCAAAAATTATCAATACAAAAAAATTAACTGCCAGAGACTTTCAAAAACTGGAACGTGAAGCAAGGATCTG
CAGAAAGTTACACCATCCCAACATAGTGCGGCTACATGACAGTATACAGGAGGAGAACTATCACTACCTTGTTTTTGACC
TTGTAACCGGTGGTGAACTTTTTGAAGATATCGTTGCACGCGAATTTTATTCAGAAGCTGATGCATCACATTGTATTCAA
CAAATATTGGAATCGGTCAATCACTGCCACCAAAATGGTGTGGTGCACCGAGATCTGAAACCAGAGAATTTACTATTAGC
TAGTAAGGCTAAGGGTGCAGCAGTGAAACTCGCTGACTTTGGTCTAGCCATTGAAGTTCAAGGCGATCATCAGGCTTGGT
TTGGATTTGCCGGCACACCAGGATATCTGTCTCCTGAGGTATTGAAAAAGGAGCCCTATGGGAAATCGGTAGACATATGG
GCATGTGGAGTTATTCTTTACATACTTCTTGTCGGTTATCCACCCTTTTGGGATGAAGATCAGCACCGACTGTACTCGCA
GATAAAAGCGGGAGCTTATGATTATCCGTCTCCAGAATGGGATACGGTTACTCCAGAAGCTAAAAATCTTATTAATCAAA
TGCTAACCGTTAATCCAAATAAACGAATAACTGCAGCTGAGGCTTTAAAACATCCGTGGATTTGTCAACGCGAACGTGTG
GCTTCCGTTGTGCATCGCCAAGAAACCGTAGACTGTCTCAAGAAATTTAATGCGCGGCGCAAGCTAAAGGGAGCCATACT
TACGACAATGTTGGCGACCAGAAATTTTTCGAGCAGAAGTATGATAACTAAAAAAGGTGAAGGATCACAGGTCAAAGAAT
CAACCGATTCATCTAGCACTACTCTTGAAGACGATGACATAAAAGAAGATAAAAAAGGAACCGTTGATCGCAGTACTACA
GTCGTATCAAAAGAGCCTGAAGATATAAGGATACTGTGTCCTGCAAAAACTTATCAGCAAAATATAGGAAACTCGCAGTG
CTCTTCAGCAGCTAGACGACAAGAAATAATAAAGATAACTGAGCAGTTGATTGAAGCAATTAACAGTGGCGACTTTGATG
GATACACCAAAATATGTGATCCGCATCTAACTGCCTTTGAGCCGGAAGCACTGGGTAACCTTGTAGAAGGAATTGATTTT
CATAAATTTTATTTTGAAAATGTTCTTGGTAAAAACTGCAAAGCTATAAACACAACCATTTTAAATCCTCATGTGCACTT
ACTTGGTGAAGAAGCCGCTTGCATTGCCTATGTGAGACTTACGCAGTACATTGATAAGCAAGGACATGCACATACCCATC
AGTCCGAGGAGACGCGAGTCTGGCACAAACGCGATAACAAATGGCAGAATGTTCATTTTCATCGAAGTGCATCTGCCAAA
ATAAGCGGAGCAACTACATTCGATTTTATACCCCAAAAATAGTGGGCATTAATCAATGGAATATAAACTGTCATTATGCA
CATGTTAATGAAAGTGCTACATTTATGTTTAGAGAACGCAATAGTTTATTGCGAATAAAGATGCTAGTGCAAATTTTATT
AATTT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0089218
3589
FBtr0089219
3730
FBtr0089217
3759
FBtr0100146
3879
FBtr0100147
3816
FBtr0100148
3837
FBtr0300377
2371
FBtr0300378
3775
FBtr0333673
3735
FBtr0333674
3855
FBtr0333675
3801
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0289608
531
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0088282
490
FBpp0088283
509
FBpp0088281
490
FBpp0099496
530
FBpp0099497
509
FBpp0099498
516
FBpp0289606
490
FBpp0289607
530
FBpp0305829
482
FBpp0305830
522
FBpp0305831
504
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
CaMKII-RJ
Secondary FlyBase IDs
    References (0)