Open Close
General Information
Symbol
Dmel\CaMKII-RC
Species
D. melanogaster
Annotation Symbol
CG18069-RC
FlyBase ID
FBtr0089217
Feature type
Associated gene
Evidence Rank
Length (nt)
3759
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 313 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          AGTCAGTATTGAATTCGATTTTCAAGAAAACAGACGTTCTAAAAATTTCGGTATCTAGCTGTGTGTTTCGTGTTCTCCCA
          GCTCGTTAAAAACATATACATATAGCTTTTTAAATACTCTTATAAGCATTTTGAACAAACATTTATCAGATCTCCTGAAG
          TTTAAAATATTGTTATTCGCAATTGAAAAGAACACATCAAGTATAGAAAACAAGAAATAAAACTCCTGAAAAGTGAAATC
          TGTAGAGCAGTTGAAGATCTTTAGTCGCAATAGATTTTCTTAAGTGTGCCATCGCGATGGCTGCACCAGCAGCCTGTACG
          CGTTTTTCGGACAATTACGACATCAAAGAAGAGTTGGGAAAAGGAGCATTCTCAATTGTGAAAAGATGTGTCCAAAAGTC
          AACTGGCTTTGAATTTGCTGCAAAAATTATCAATACAAAAAAATTAACTGCCAGAGACTTTCAAAAACTGGAACGTGAAG
          CAAGGATCTGCAGAAAGTTACACCATCCCAACATAGTGCGGCTACATGACAGTATACAGGAGGAGAACTATCACTACCTT
          GTTTTTGACCTTGTAACCGGTGGTGAACTTTTTGAAGATATCGTTGCACGCGAATTTTATTCAGAAGCTGATGCATCACA
          TTGTATTCAACAAATATTGGAATCGGTCAATCACTGCCACCAAAATGGTGTGGTGCACCGAGATCTGAAACCAGAGAATT
          TACTATTAGCTAGTAAGGCTAAGGGTGCAGCAGTGAAACTCGCTGACTTTGGTCTAGCCATTGAAGTTCAAGGCGATCAT
          CAGGCTTGGTTTGGATTTGCCGGCACACCAGGATATCTGTCTCCTGAGGTATTGAAAAAGGAGCCCTATGGGAAATCGGT
          AGACATATGGGCATGTGGAGTTATTCTTTACATACTTCTTGTCGGTTATCCACCCTTTTGGGATGAAGATCAGCACCGAC
          TGTACTCGCAGATAAAAGCGGGAGCTTATGATTATCCGTCTCCAGAATGGGATACGGTTACTCCAGAAGCTAAAAATCTT
          ATTAATCAAATGCTAACCGTTAATCCAAATAAACGAATAACTGCAGCTGAGGCTTTAAAACATCCGTGGATTTGTCAACG
          CGAACGTGTGGCTTCCGTTGTGCATCGCCAAGAAACCGTAGACTGTCTCAAGAAATTTAATGCGCGGCGCAAGCTAAAGG
          GAGCCATACTTACGACAATGTTGGCGACCAGAAATTTTTCGAGCAGAAGTATGATAACTAAAAAAGGTGAAGGATCACAG
          GTCAAAGAATCAACCGATTCATCTAGCACTACTCTTGAAGACGATGACATAAAAGCAGCTAGACGACAAGAAATAATAAA
          GATAACTGAGCAGTTGATTGAAGCAATTAACAGTGGCGACTTTGATGGATACACCAAAATATGTGATCCGCATCTAACTG
          CCTTTGAGCCGGAAGCACTGGGTAACCTTGTAGAAGGAATTGATTTTCATAAATTTTATTTTGAAAATGTTCTTGGTAAA
          AACTGCAAAGCTATAAACACAACCATTTTAAATCCTCATGTGCACTTACTTGGTGAAGAAGCCGCTTGCATTGCCTATGT
          GAGACTTACGCAGTACATTGATAAGCAAGGACATGCACATACCCATCAGTCCGAGGAGACGCGAGTCTGGCACAAACGCG
          ATAACAAATGGCAGAATGTTCATTTTCATCGAAGTGCATCTGCCAAAATAAGCGGAGCAACTACATTCGATTTTATACCC
          CAAAAATAGTGGGCATTAATCAATGGAATATAAACTGTCATTATGCACATGTTAATGAAAGTGCTACATTTATGTTTAGA
          GAACGCAATAGTTTATTGCGAATAAAGATGCTAGTGCAAATTTTATTAATTTATTTACCTTTTGAAATAAAACTATCTAA
          AGCATATATCACATTTTAGATATCTCATTGAACCACATTTACTTGAGAAATTAAAGTAGCAAACACAAATATAAAGATCA
          ATCACAAATATTTGTTGTAAGTGTCGTGGTACCAATTGTAAGCTTAAACGTTCTCAACGGAAGAATCAAGTTTATTATTT
          AACTATTATTATTATTATTAAAATAAAATTGACAACTTTGTATCTATTGGAACATCTAAAATAAATTCCAATAACTTTAT
          TGACGTCTCAAAACAATTGCAAACAATTTAGAACCCTTGAGTTATCTACTAGGATACGAATATCATTTGGTTTGCAAAGT
          CCGCTTATTCTCGTTCTTAAAATAAATACACACATATAAAGTTTAATAAAACGTGTGAGTACATGCGTTTACAAATTACT
          GAAGTTAGCACTATCAATATATGTAACTGTAAAGCATTAGGTTATTACAATGAAACATATACCATTTGGAAAAATTAAGT
          ACGTTTAAAAGAAAAAAGGAACGAAAATTAGCTAACTGAAATATAAATCTAAGTCCCAATAATTGAAATTATGCGACTAC
          TTCGAATTACTTATATTTACATAAATATACTTAGGCATTTTATCCAAGTTAAAAAATACTTTCTGTATTTCACCGTACAT
          ATTTCTTTCTGATGTTGAACAAACTTTTTATATTTTATGTTTTAATAGAAATATAACTTTGTTCTTATTATTTGAAAAGA
          TGTCCAAGGCTTAAAAAGTAATCCTTTTTTTGTTCATAGAATTTTAAATTCCCTTTTGTTCTAGAAATTGATTGCTTGTC
          TTAAAAAAATGCATGAGGGGAGCCAAAGAATTATGTTTAATTAGTATCATAGTTGAAAATATAAATTCAATCCAATATCC
          ATGTACCAAAAGTAATTCCAATCAATCCATTGTTAAGCTAACAGACGTAACATAATCAACGGAGTTGGTATCAGTATATT
          AACTTGATCTTTTCCAATAGATGCCGAATAGCTTTTTGATTTTTTACAACTATAACAATGCTAACCGTGTTGACACCGAT
          TAAAAATGTAACCGATAAAAAATTTTAAATATCTTCGAAGAATTTTTAAAGATAATAATAAAAAGAATTCTTGGGACGCT
          AATGCACAAACAGCAGGAAAAATACCTATATCTGTCAATAGAAACATTAAGTATAATTACAAAGGTTATTGTGTTTCGCT
          TTATATTGTGTTTACACCTTATGGGCAAATAGCTAATTTAAACAATGCGATATGATAAACATAACAAAAATTATATTTCT
          TTTTTACTAAATGAATAATTTTGTGGTATGAGCATAACTGCGAAAATAACTTGTAACTTAACTTAATCATTGTGAAATGA
          TTATACATTTTACCTGATAGTACATGTTAAAAAAAAACTTGGACTTAAACACATTTAAAAAGTTTGCCAGATATATTTTA
          AAGTAAAAAAGATTATACTACGGTCTACAATAAGTTGAACTTTAGTTGCATCCCACGGTTTTCCATAATTACTCATCAAT
          TCCTTTACCAATGCTTGCAGAGTACTTGATTCTTTTTGTCTAATACTATTGGTCTATATACAGTTGCTTAAATTCAATTT
          TTAGGACCTAAATGTCTTCACAAATCAATTTTAATAATAATTACACGATAACAATTATACGAACAAGCTTTGGATACATT
          ATATTGATCGAAAAGCTTTCGCTCCTAAGGTAAAAGCCTATAAAATAATAACCGAAAATAATTTATGTTTCTCAAAGTAT
          ATCCAAATAATTATAATAAATTTTTTTGTTAGTGGATGTCCTTTATATTTTGAGGGAATTCAAAGCATAATGCAATTTT
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0089218
          3589
          FBtr0089219
          3730
          FBtr0100146
          3879
          FBtr0100147
          3816
          FBtr0100148
          3837
          FBtr0300377
          2371
          FBtr0300378
          3775
          FBtr0300379
          1845
          FBtr0333673
          3735
          FBtr0333674
          3855
          FBtr0333675
          3801
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0088281
          490
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0088282
          490
          FBpp0088283
          509
          FBpp0099496
          530
          FBpp0099497
          509
          FBpp0099498
          516
          FBpp0289606
          490
          FBpp0289607
          530
          FBpp0289608
          531
          FBpp0305829
          482
          FBpp0305830
          522
          FBpp0305831
          504
          Comments

          Extended 3' UTR based on RNA-Seq and/or EST data.

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (2)
          Reported As
          Symbol Synonym
          CG18069-RC
          CaMKII-RC
          Secondary FlyBase IDs
            References (2)