Open Close
General Information
Symbol
Dmel\swm-RC
Species
D. melanogaster
Annotation Symbol
CG10084-RC
FlyBase ID
FBtr0331325
Feature type
Associated gene
Evidence Rank
Length (nt)
4151
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 102 )
Sequence
ATCGACTACGCAGCCTAGACTCGTCAAAAGCAACCTTGCAACAGGAAAAGTGCAGTGAAAAATATAAAAATAGCTGTTCA
AACCACAATTTGTTGTACAAATCTTAATAATAAGTTAAATTTAAGCATTGAGAGATTAAAAGCAGAAGCAACGGCGGTAA
CAGGAAGTAAGAAGTTCACCCAAATCGCAGGAGCACAGTCGCCAGAGCGACAGAGGTCATCTTAAAAATAATTTTTCGGG
CGTGTTTGCCCCCCGAGCACGATTAACCCCCCACCCAGATTAGCGCAGACCAACGCAAGAAGCCCCCAACCAAAAAACAA
AAACAACAGCAGCAGCAGCAAGCAGTAGAAACAACCCGCCTTAGCATGATTCTGGAGAATTCGGACAAGCTCAAGGATTG
GCTGAGCGTGGTCCTGGAGCCACTCTGCGATGCGGACTCCTCGGCCTTGGCGCGATATGTCATCGCGCTGCTCAAGAAGG
ACAAATCGGATAAAGACCTTAAGCGGATCATGATCGAACAGCTCGATGTTTTCCTGTCCGAGGAGACGACACGTTTCGTT
GAACGCCTCTTCGATGCCATTGCCAGCGAGGAATACCTGACGGTCCCTGCTGCCCCTCTAATAACAGCCTCTAGTGCATC
CACCGCTGAGCTAACAGTCGACCAGGAACTGGCCCTGGTCATTGATGGGCCCCAGGACGACATCGAAGCGGTTTTGGTTG
CCGATTCCCCTCCACCGCCTCCTAAAGATAATGTGATAAAACCCGATAGCAATCAGGTCAAGTTAGAGCAGGCCAGTCAA
GATGCCAGGGAAGCTGAGGCCCTAGCTTTTATCAGCCAGGAAGCCGGCATTGCCATGCACGTCCCTACAGATGCCAAGCC
AGCCTTTGATCAGCATAAAACCAAAGACTCCCACAATCAACAGTCAGCCTCCAACTACCAACACCATCATGTGCGCAGTG
CCAGCCCACCGGGCAGAAGCAGCGGCGTCAGCGGAAGTGGAGGAGGTGGTCCCGGCGGAGCAGGTCTTGCGGCGGGTTAT
GCTGACAAGGAAAACCAGCCGCGCGACAGTCGACGACGACGTGCTTCCCTGCGATCCCGTTCCCGCTCTCGATCGCGTTC
TAACGAGCGCGCTTTTCGGCGGTCCAGGTCACGCGACCGACGGGTGAACGAACGCGAGAAAACTCAACGACAATTCCGTA
ACAAATCTCCACCAGGCTCGCAGACCGACAATCGCCATCATGGTCGGCGCAACTTTGATCGCCGGCGCATCGGTGGCAAC
GCAGATGATCGTCCTCGATTTGGCAACAATAAGAGCCGGCGCTCTCACAGTCGGTCAATGTCACCGGAACGAAACGCGCG
GCGCAACCAGAACTCCCCGGACCGAGTACAAACAGCCCAAGCTAACCTAATTCCCGCTCCAGTGGCGCCGCCAGCACCCG
TTGAGCATCCGGCTTCCCATCCTCGTCAGCGCTGCCGGGACTTTGACGAGAAGGGCTATTGTGTCAGGGGTGAAACATGT
CCCTGGGACCATGGCGTCAATCCGGTAGTGTTCGAGGGCATCAACAACACGTCCCTCATGATGTCAATGCGCGAGTACAA
TCCGGATGCGCCCGAAATATGGGCTAGGAGCGGAGGTCCGCCACCAGGAGCTGGTCAGGGACCAGTGCCTCCACCAACGC
AACCAGGACAGACCACCATTAACCCCTTCAGCGGTAATGTGCGACCAACCACGCTAATGAGCGGCTCTGGGCCCAGTCCG
ATGGGCGTTCCGAATCCCGCTGACTACGCGCGCAATCCAGGCGCTCCGCCGCAGGCGGCCATGATGCCATTCCCTTTCAA
TCCCACTGCGGTTACCACTCCCTTGCAGCGGCAGCTGATACCTATTCCCGTGGTTGATGGCGCTCCCACGGGAGGCGTTG
CTGAGGTTGGTAAGCGACGTTTCGAACTGGAGGATACAGTGGCCATTGCCGATGTGCCAACGAAACGAAAGGTGCCGATC
AACAGTCGTCTTGGCCCGCGTGTCAATCCCAACATGCAGCAGCATAACAGTTCGCTGGAGCTGAGGAAGGTACCGCGCGG
ACTTAACACCATCGCTCATTTGAACAACCACTTTGCTAAGTTCGGAAAGATCGTTAACATTCAGGTTTCGTACGAAGGCG
ATCCAGAGGCAGCTATCGTGACTTTTTCCACTCATGCTGAAGCTAATGTGGCCTACAGGAGCACGGAGGCGGTGCTAAAC
AACCGATTTATTAAGGTCTTCTGGCATAACGACAGCAGCGGAGCGGATGTGGGACAGATGAACCAGATGGGCGGCGGTGG
AGGAGGCGGTGGACGGAAGAACGCCAGCCAGTACCATCTGCATAACGTTCCGGCAGTGCCAACACCCAATGCGGATGGTG
CGAAGATCAGCAATGCCAATCCTCTGACTGAGGCGGGAGCTGGTAACATTGGCACCCCTGCCACGGAACAGGCCAACACA
GCGGCTCCGGCATCAATGCGTCTCAAGCTAAATACAACGACAGCTGGCGGCTCAGCTGGAGGAGCAGCTGGTGCGGGAGC
ACCGGGATCAGGTCGTCCTTTGAACCCTGCCGCCAATGCCGCTAGCATACGCAAGAAGCAGGAGGAGCAGCAGAAAGCAG
TTCACCAACTGGCTAACGGGTTGCGCAAACGCAAACAAGAATTGCTCCAGAGCTATATGAAGCAGATGAAGACTGCTCTG
GAACTGGTGGAGCGAATGGACCAGCAGGATCCTCAGAGGGCCCCTACTCTGCAGACAATAAAGGTGCTGCAGATGACAAT
CGACAAACTACGAAAGGAAATCAAGGCCGACCAGGATCAGTTGCAAGCACAAATGCAGCAACAACAGCAGCAGCAACAGC
CGCCCGTCAAGAAGACCAAGGAGCAGCAGAAGAAGGAATTGCTTGACATGGAACTGGAGCTAATCGCCCAGCAACAGGAG
GGCAACGACACTACAGCCATTCAGAAGCGATTGGAGGAGTTACAGCGCAATCTTGGTGTTGGCTCAGCTGCGAATAACAA
GTCTACCCACTATGCACCTGCTTCCGGGGCACCCGGTGGCGGTGCAGGACGCAAGCGTCCGAATCTGCCGGAGGGACCCA
CTCGTGTCGACAGGCGGCCAAAGGCCATCGTGGTCACTGGCTTTGCGGCCGAAGAGGCAGACTTTGTCCTCGGGCACTTT
AAGAACTTCGGCGAGATTTCTAAGCATGATGTAGACCGTGAGATTCCACAGTTAATACTCTCATACGCAACCCGTCTCAA
CGCCGAACAGGCTGTGCTCCGGGGCAAAATGTACAAAGACAAGCGCCTGCAGATCTCGTGGGCTCCCGTGGTGACTCCCG
CTCCAGCTCCAATGGCCGCCCCTGTTGAGAAGTCCGCTGCACCAGGTGACATGTCCGTTAGCCTAGAGAACCCCAAACAA
TTAATCCAGTCCGTCAGTGAGAGCGAGAGTCTGTTAGGCAGCGACACGCTGCCGGAGCTGCGCCTGGAAGATGAGGAGGA
GGATGAGGAGTCCGAGGATCGCTCCTGGCGTCGTTGATCCATCGCCCTCCGCTGTTGAGGCGGCCGGGAAAGTTCCGTGG
GGCTCACAAGTGTTAGGAAACCCTTAACATGTATTTGTTGTTATTCTATATCTAACTGCTGAGTGTGTGGCAGTGCTGAG
AATGAACGAACACTTTGCACACTTCAATTAAACGCTCTAAATATTACTAATATTTTACTGAACATAAGTTATGAATCGCC
TAAAAATACGAATGAGTTTAGCTAAGCCTAAGTCCGAAATAACAACACTGAAACTACAACTTCAACAGCGAAATGCAACC
AAACTCCAAGGCTCGATGCGAAAAAGCGCGAGACAAAACATTGGTTAAAGATCGTGAACTACCTTTGTATTTACACATTT
TTCACTCTATCCTTTTCTTATATACAAATATATATACGCGGATATATAATTGTTAAGATTTTATGTTGAGTTAAAACGAT
AAAACACTAAAAGAACAAAAAAATTGCAAAGAAAAAATCCCCAAAAACAAGCGCAATGAAAGTCAAAAAAAGAAAAAAAT
CGTAGCAACGTGAATGCAAAACAGCAAGTTATATAGAGAGATATAATAAATAAAATAGTTTCGTATTTCAG
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0081244
4005
FBtr0081245
4114
FBtr0331326
3974
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0303743
1063
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0080785
1062
FBpp0080786
1062
FBpp0303744
1063
Comments

Extended 3' UTR based on EST and RNA-Seq data.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
swm-RC
Secondary FlyBase IDs
    References (0)