Open Close
General Information
Symbol
Dmel\swm-RA
Species
D. melanogaster
Annotation Symbol
CG10084-RA
FlyBase ID
FBtr0081244
Feature type
Associated gene
Evidence Rank
Length (nt)
4005
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 112 )
Sequence
ATCGACTACGCAGCCTAGACTCGTCAAAAGCAACCTTGCAACAGGAAAAGTGCAGTGAAAAATATAAAAATAGCTGTTCA
AACCACAATTTGTTGTACAAATCTTAATAATAAGTTAAATTTAAGCATTGAGAGATTAAAAGCAGAAGCAACGGCGGTAA
CAGGAAGTAAGAAGTTCACCCAAATCGCAGGAGCACAGTCGCCAGAGCGACAGAGGTCATCTTAAAAATAATTTTTCGGG
CGTGTTTGCCCCCCGAGCACGATTAACCCCCCACCCAGATTAGCGCAGACCAACGCAAGAAGCCCCCAACCAAAAAACAA
AAACAACAGCAGCAGCAGCAAGCAGTAGAAACAACCCGCCTTAGCATGATTCTGGAGAATTCGGACAAGCTCAAGGATTG
GCTGAGCGTGGTCCTGGAGCCACTCTGCGATGCGGACTCCTCGGCCTTGGCGCGATATGTCATCGCGCTGCTCAAGAAGG
ACAAATCGGATAAAGACCTTAAGCGGATCATGATCGAACAGCTCGATGTTTTCCTGTCCGAGGAGACGACACGTTTCGTT
GAACGCCTCTTCGATGCCATTGCCAGCGAGGAATACCTGACGGTCCCTGCTGCCCCTCTAATAACAGCCTCTAGTGCATC
CACCGCTGAGCTAACAGTCGACCAGGAACTGGCCCTGGTCATTGATGGGCCCCAGGACGACATCGAAGCGGTTTTGGTTG
CCGATTCCCCTCCACCGCCTCCTAAAGATAATGTGATAAAACCCGATAGCAATCAGGTCAAGTTAGAGCAGGCCAGTCAA
GATGCCAGGGAAGCTGAGGCCCTAGCTTTTATCAGCCAGGAAGCCGGCATTGCCATGCACGTCCCTACAGATGCCAAGCC
AGCCTTTGATCATAAAACCAAAGACTCCCACAATCAACAGTCAGCCTCCAACTACCAACACCATCATGTGCGCAGTGCCA
GCCCACCGGGCAGAAGCAGCGGCGTCAGCGGAAGTGGAGGAGGTGGTCCCGGCGGAGCAGGTCTTGCGGCGGGTTATGCT
GACAAGGAAAACCAGCCGCGCGACAGTCGACGACGACGTGCTTCCCTGCGATCCCGTTCCCGCTCTCGATCGCGTTCTAA
CGAGCGCGCTTTTCGGCGGTCCAGGTCACGCGACCGACGGGTGAACGAACGCGAGAAAACTCAACGACAATTCCGTAACA
AATCTCCACCAGGCTCGCAGACCGACAATCGCCATCATGGTCGGCGCAACTTTGATCGCCGGCGCATCGGTGGCAACGCA
GATGATCGTCCTCGATTTGGCAACAATAAGAGCCGGCGCTCTCACAGTCGGTCAATGTCACCGGAACGAAACGCGCGGCG
CAACCAGAACTCCCCGGACCGAGTACAAACAGCCCAAGCTAACCTAATTCCCGCTCCAGTGGCGCCGCCAGCACCCGTTG
AGCATCCGGCTTCCCATCCTCGTCAGCGCTGCCGGGACTTTGACGAGAAGGGCTATTGTGTCAGGGGTGAAACATGTCCC
TGGGACCATGGCGTCAATCCGGTAGTGTTCGAGGGCATCAACAACACGTCCCTCATGATGTCAATGCGCGAGTACAATCC
GGATGCGCCCGAAATATGGGCTAGGAGCGGAGGTCCGCCACCAGGAGCTGGTCAGGGACCAGTGCCTCCACCAACGCAAC
CAGGACAGACCACCATTAACCCCTTCAGCGGTAATGTGCGACCAACCACGCTAATGAGCGGCTCTGGGCCCAGTCCGATG
GGCGTTCCGAATCCCGCTGACTACGCGCGCAATCCAGGCGCTCCGCCGCAGGCGGCCATGATGCCATTCCCTTTCAATCC
CACTGCGGTTACCACTCCCTTGCAGCGGCAGCTGATACCTATTCCCGTGGTTGATGGCGCTCCCACGGGAGGCGTTGCTG
AGGTTGGTAAGCGACGTTTCGAACTGGAGGATACAGTGGCCATTGCCGATGTGCCAACGAAACGAAAGGTGCCGATCAAC
AGTCGTCTTGGCCCGCGTGTCAATCCCAACATGCAGCAGCATAACAGTTCGCTGGAGCTGAGGAAGGTACCGCGCGGACT
TAACACCATCGCTCATTTGAACAACCACTTTGCTAAGTTCGGAAAGATCGTTAACATTCAGGTTTCGTACGAAGGCGATC
CAGAGGCAGCTATCGTGACTTTTTCCACTCATGCTGAAGCTAATGTGGCCTACAGGAGCACGGAGGCGGTGCTAAACAAC
CGATTTATTAAGGTCTTCTGGCATAACGACAGCAGCGGAGCGGATGTGGGACAGATGAACCAGATGGGCGGCGGTGGAGG
AGGCGGTGGACGGAAGAACGCCAGCCAGTACCATCTGCATAACGTTCCGGCAGTGCCAACACCCAATGCGGATGGTGCGA
AGATCAGCAATGCCAATCCTCTGACTGAGGCGGGAGCTGGTAACATTGGCACCCCTGCCACGGAACAGGCCAACACAGCG
GCTCCGGCATCAATGCGTCTCAAGCTAAATACAACGACAGCTGGCGGCTCAGCTGGAGGAGCAGCTGGTGCGGGAGCACC
GGGATCAGGTCGTCCTTTGAACCCTGCCGCCAATGCCGCTAGCATACGCAAGAAGCAGGAGGAGCAGCAGAAAGCAGTTC
ACCAACTGGCTAACGGGTTGCGCAAACGCAAACAAGAATTGCTCCAGAGCTATATGAAGCAGATGAAGACTGCTCTGGAA
CTGGTGGAGCGAATGGACCAGCAGGATCCTCAGAGGGCCCCTACTCTGCAGACAATAAAGGTGCTGCAGATGACAATCGA
CAAACTACGAAAGGAAATCAAGGCCGACCAGGATCAGTTGCAAGCACAAATGCAGCAACAACAGCAGCAGCAACAGCCGC
CCGTCAAGAAGACCAAGGAGCAGCAGAAGAAGGAATTGCTTGACATGGAACTGGAGCTAATCGCCCAGCAACAGGAGGGC
AACGACACTACAGCCATTCAGAAGCGATTGGAGGAGTTACAGCGCAATCTTGGTGTTGGCTCAGCTGCGAATAACAAGTC
TACCCACTATGCACCTGCTTCCGGGGCACCCGGTGGCGGTGCAGGACGCAAGCGTCCGAATCTGCCGGAGGGACCCACTC
GTGTCGACAGGCGGCCAAAGGCCATCGTGGTCACTGGCTTTGCGGCCGAAGAGGCAGACTTTGTCCTCGGGCACTTTAAG
AACTTCGGCGAGATTTCTAAGCATGATGTAGACCGTGAGATTCCACAGTTAATACTCTCATACGCAACCCGTCTCAACGC
CGAACAGGCTGTGCTCCGGGGCAAAATGTACAAAGACAAGCGCCTGCAGATCTCGTGGGCTCCCGTGGTGACTCCCGCTC
CAGCTCCAATGGCCGCCCCTGTTGAGAAGTCCGCTGCACCAGGTGACATGTCCGTTAGCCTAGAGAACCCCAAACAATTA
ATCCAGTCCGTCAGTGAGAGCGAGAGTCTGTTAGGCAGCGACACGCTGCCGGAGCTGCGCCTGGAAGATGAGGAGGAGGA
TGAGGAGTCCGAGGATCGCTCCTGGCGTCGTTGATCCATCGCCCTCCGCTGTTGAGGCGGCCGGGAAAGTTCCGTGGGGC
TCACAAGTGTTAGGAAACCCTTAACATGTATTTGTTGTTATTCTATATCTAACTGCTGAGTGTGTGGCAGTGCTGAGAAT
GAACGAACACTTTGCACACTTCAATTAAACGCTCTAAATATTACTAATATTTTACTGAACATAAGTTATGAATCGCCTAA
AAATACGAATGAGTTTAGCTAAGCCTAAGTCCGAAATAACAACACTGAAACTACAACTTCAACAGCGAAATGCAACCAAA
CTCCAAGGCTCGATGCGAAAAAGCGCGAGACAAAACATTGGTTAAAGATCGTGAACTACCTTTGTATTTACACATTTTTC
ACTCTATCCTTTTCTTATATACAAATATATATACGCGGATATATAATTGTTAAGATTTTATGTTGAGTTAAAACGATAAA
ACACT
Other Products of this Gene
Other Transcripts
Name
FlyBase ID
Length (nt)
FBtr0081245
4114
FBtr0331325
4151
FBtr0331326
3974
Polypeptides
Derived from THIS transcript
Name
FlyBase ID
Length (aa)
FBpp0080785
1062
Derived from OTHER transcripts
Name
FlyBase ID
Length (aa)
FBpp0080786
1062
FBpp0303743
1063
FBpp0303744
1063
Comments

Transcript terminates at site supported by polyadenylated cDNA.

External Crossreferences and Linkouts ( 1 )
Crossreferences
RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
CG10084-RA
Secondary FlyBase IDs
    References (2)