Open Close
General Information
Symbol
Dmel\swm-RB
Species
D. melanogaster
Annotation Symbol
CG10084-RB
FlyBase ID
FBtr0081245
Feature type
Associated gene
Evidence Rank
Length (nt)
4114
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 62 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
        Sequence
        TTTCTTATTGACGATAGCAGATGGGAAGAAGAAGCAATTAAAAGAAGGAAGGAAAAAGTACGACAAAAAGTAAAATAAAC
        GCCGAAATCCAATTTCAGAGATTAAAAGCAGAAGCAACGGCGGTAACAGGAAGTAAGAAGTTCACCCAAATCGCAGGAGC
        ACAGTCGCCAGAGCGACAGAGGTCATCTTAAAAATAATTTTTCGGGCGTGTTTGCCCCCCGAGCACGATTAACCCCCCAC
        CCAGATTAGCGCAGACCAACGCAAGAAGCCCCCAACCAAAAAACAAAAACAACAGCAGCAGCAGCAAGCAGTAGAAACAA
        CCCGCCTTAGCATGATTCTGGAGAATTCGGACAAGCTCAAGGATTGGCTGAGCGTGGTCCTGGAGCCACTCTGCGATGCG
        GACTCCTCGGCCTTGGCGCGATATGTCATCGCGCTGCTCAAGAAGGACAAATCGGATAAAGACCTTAAGCGGATCATGAT
        CGAACAGCTCGATGTTTTCCTGTCCGAGGAGACGACACGTTTCGTTGAACGCCTCTTCGATGCCATTGCCAGCGAGGAAT
        ACCTGACGGTCCCTGCTGCCCCTCTAATAACAGCCTCTAGTGCATCCACCGCTGAGCTAACAGTCGACCAGGAACTGGCC
        CTGGTCATTGATGGGCCCCAGGACGACATCGAAGCGGTTTTGGTTGCCGATTCCCCTCCACCGCCTCCTAAAGATAATGT
        GATAAAACCCGATAGCAATCAGGTCAAGTTAGAGCAGGCCAGTCAAGATGCCAGGGAAGCTGAGGCCCTAGCTTTTATCA
        GCCAGGAAGCCGGCATTGCCATGCACGTCCCTACAGATGCCAAGCCAGCCTTTGATCATAAAACCAAAGACTCCCACAAT
        CAACAGTCAGCCTCCAACTACCAACACCATCATGTGCGCAGTGCCAGCCCACCGGGCAGAAGCAGCGGCGTCAGCGGAAG
        TGGAGGAGGTGGTCCCGGCGGAGCAGGTCTTGCGGCGGGTTATGCTGACAAGGAAAACCAGCCGCGCGACAGTCGACGAC
        GACGTGCTTCCCTGCGATCCCGTTCCCGCTCTCGATCGCGTTCTAACGAGCGCGCTTTTCGGCGGTCCAGGTCACGCGAC
        CGACGGGTGAACGAACGCGAGAAAACTCAACGACAATTCCGTAACAAATCTCCACCAGGCTCGCAGACCGACAATCGCCA
        TCATGGTCGGCGCAACTTTGATCGCCGGCGCATCGGTGGCAACGCAGATGATCGTCCTCGATTTGGCAACAATAAGAGCC
        GGCGCTCTCACAGTCGGTCAATGTCACCGGAACGAAACGCGCGGCGCAACCAGAACTCCCCGGACCGAGTACAAACAGCC
        CAAGCTAACCTAATTCCCGCTCCAGTGGCGCCGCCAGCACCCGTTGAGCATCCGGCTTCCCATCCTCGTCAGCGCTGCCG
        GGACTTTGACGAGAAGGGCTATTGTGTCAGGGGTGAAACATGTCCCTGGGACCATGGCGTCAATCCGGTAGTGTTCGAGG
        GCATCAACAACACGTCCCTCATGATGTCAATGCGCGAGTACAATCCGGATGCGCCCGAAATATGGGCTAGGAGCGGAGGT
        CCGCCACCAGGAGCTGGTCAGGGACCAGTGCCTCCACCAACGCAACCAGGACAGACCACCATTAACCCCTTCAGCGGTAA
        TGTGCGACCAACCACGCTAATGAGCGGCTCTGGGCCCAGTCCGATGGGCGTTCCGAATCCCGCTGACTACGCGCGCAATC
        CAGGCGCTCCGCCGCAGGCGGCCATGATGCCATTCCCTTTCAATCCCACTGCGGTTACCACTCCCTTGCAGCGGCAGCTG
        ATACCTATTCCCGTGGTTGATGGCGCTCCCACGGGAGGCGTTGCTGAGGTTGGTAAGCGACGTTTCGAACTGGAGGATAC
        AGTGGCCATTGCCGATGTGCCAACGAAACGAAAGGTGCCGATCAACAGTCGTCTTGGCCCGCGTGTCAATCCCAACATGC
        AGCAGCATAACAGTTCGCTGGAGCTGAGGAAGGTACCGCGCGGACTTAACACCATCGCTCATTTGAACAACCACTTTGCT
        AAGTTCGGAAAGATCGTTAACATTCAGGTTTCGTACGAAGGCGATCCAGAGGCAGCTATCGTGACTTTTTCCACTCATGC
        TGAAGCTAATGTGGCCTACAGGAGCACGGAGGCGGTGCTAAACAACCGATTTATTAAGGTCTTCTGGCATAACGACAGCA
        GCGGAGCGGATGTGGGACAGATGAACCAGATGGGCGGCGGTGGAGGAGGCGGTGGACGGAAGAACGCCAGCCAGTACCAT
        CTGCATAACGTTCCGGCAGTGCCAACACCCAATGCGGATGGTGCGAAGATCAGCAATGCCAATCCTCTGACTGAGGCGGG
        AGCTGGTAACATTGGCACCCCTGCCACGGAACAGGCCAACACAGCGGCTCCGGCATCAATGCGTCTCAAGCTAAATACAA
        CGACAGCTGGCGGCTCAGCTGGAGGAGCAGCTGGTGCGGGAGCACCGGGATCAGGTCGTCCTTTGAACCCTGCCGCCAAT
        GCCGCTAGCATACGCAAGAAGCAGGAGGAGCAGCAGAAAGCAGTTCACCAACTGGCTAACGGGTTGCGCAAACGCAAACA
        AGAATTGCTCCAGAGCTATATGAAGCAGATGAAGACTGCTCTGGAACTGGTGGAGCGAATGGACCAGCAGGATCCTCAGA
        GGGCCCCTACTCTGCAGACAATAAAGGTGCTGCAGATGACAATCGACAAACTACGAAAGGAAATCAAGGCCGACCAGGAT
        CAGTTGCAAGCACAAATGCAGCAACAACAGCAGCAGCAACAGCCGCCCGTCAAGAAGACCAAGGAGCAGCAGAAGAAGGA
        ATTGCTTGACATGGAACTGGAGCTAATCGCCCAGCAACAGGAGGGCAACGACACTACAGCCATTCAGAAGCGATTGGAGG
        AGTTACAGCGCAATCTTGGTGTTGGCTCAGCTGCGAATAACAAGTCTACCCACTATGCACCTGCTTCCGGGGCACCCGGT
        GGCGGTGCAGGACGCAAGCGTCCGAATCTGCCGGAGGGACCCACTCGTGTCGACAGGCGGCCAAAGGCCATCGTGGTCAC
        TGGCTTTGCGGCCGAAGAGGCAGACTTTGTCCTCGGGCACTTTAAGAACTTCGGCGAGATTTCTAAGCATGATGTAGACC
        GTGAGATTCCACAGTTAATACTCTCATACGCAACCCGTCTCAACGCCGAACAGGCTGTGCTCCGGGGCAAAATGTACAAA
        GACAAGCGCCTGCAGATCTCGTGGGCTCCCGTGGTGACTCCCGCTCCAGCTCCAATGGCCGCCCCTGTTGAGAAGTCCGC
        TGCACCAGGTGACATGTCCGTTAGCCTAGAGAACCCCAAACAATTAATCCAGTCCGTCAGTGAGAGCGAGAGTCTGTTAG
        GCAGCGACACGCTGCCGGAGCTGCGCCTGGAAGATGAGGAGGAGGATGAGGAGTCCGAGGATCGCTCCTGGCGTCGTTGA
        TCCATCGCCCTCCGCTGTTGAGGCGGCCGGGAAAGTTCCGTGGGGCTCACAAGTGTTAGGAAACCCTTAACATGTATTTG
        TTGTTATTCTATATCTAACTGCTGAGTGTGTGGCAGTGCTGAGAATGAACGAACACTTTGCACACTTCAATTAAACGCTC
        TAAATATTACTAATATTTTACTGAACATAAGTTATGAATCGCCTAAAAATACGAATGAGTTTAGCTAAGCCTAAGTCCGA
        AATAACAACACTGAAACTACAACTTCAACAGCGAAATGCAACCAAACTCCAAGGCTCGATGCGAAAAAGCGCGAGACAAA
        ACATTGGTTAAAGATCGTGAACTACCTTTGTATTTACACATTTTTCACTCTATCCTTTTCTTATATACAAATATATATAC
        GCGGATATATAATTGTTAAGATTTTATGTTGAGTTAAAACGATAAAACACTAAAAGAACAAAAAAATTGCAAAGAAAAAA
        TCCCCAAAAACAAGCGCAATGAAAGTCAAAAAAAGAAAAAAATCGTAGCAACGTGAATGCAAAACAGCAAGTTATATAGA
        GAGATATAATAAATAAAATAGTTTCGTATTTCAG
        
        Other Products of this Gene
        Other Transcripts
        Name
        FlyBase ID
        Length (nt)
        FBtr0081244
        4005
        FBtr0331325
        4151
        FBtr0331326
        3974
        Polypeptides
        Derived from THIS transcript
        Name
        FlyBase ID
        Length (aa)
        FBpp0080786
        1062
        Derived from OTHER transcripts
        Name
        FlyBase ID
        Length (aa)
        FBpp0080785
        1062
        FBpp0303743
        1063
        FBpp0303744
        1063
        Comments

        Extended 3' UTR based on EST and RNA-Seq data.

        External Crossreferences and Linkouts ( 1 )
        Crossreferences
        RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
        Synonyms and Secondary IDs (2)
        Reported As
        Symbol Synonym
        CG10084-RB
        Secondary FlyBase IDs
          References (2)