Open Close
General Information
Symbol
Dmel\CG46301-RE
Species
D. melanogaster
Annotation Symbol
CG46301-RE
FlyBase ID
FBtr0445730
Feature type
Associated gene
Evidence Rank
Length (nt)
5632
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 14 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        End(s) extend beyond the annotated transcript, internally consistent
          Sequence
          TTGAACTTTCATTCGGTCGCGTCGCGTTCGCTGTTACTCATTTCTTTTTTGGCCTTTGGTTATTTGTTGGGCCGAAAAGA
          TCTGAACCCTGTTTTTCGTTTTTGTGGGATTTCTGTTATACTTTTAATATTGTTAAAAAGAAAACTCATCGTTTTGTTGA
          CTTTTTTAGTTAAATATTTGTTCAAAAAATTTGTGTCTGATATTTTGCCAAGTTTAACATACAAAAAGGACATTCCGAGA
          AATCCCACCAAACGAAGAATTGAATTCAGCTGAAATTCTAATTTCACACAAAATTCTTCCCAAAACACCCCATGTCATCG
          ATTATCGCTTGCAGTTGTCTTTGATTTGCTGTTTTTTGAGTCCCTTAAACAGTGTGTGCTTGAGTTGAGCCCCCCAAATT
          CGCATCATGGAGCACTCGAATGGCAGTGGCAAGCCTCGTACAGACCAGTCTGCGTCACCTAACCCACAGTCCTCGGCGAT
          GACTGCCTCGTCGGAGGGTTGGAGCAGCAAAAGGAAGCTCTATGCCATCGATGAGCGCGAGGAGAGCTCGCCAGTGACTG
          TGGGCAAGGTGGAGACTGATTTGGCCTACGATGCGGATGTGGACGAGCTGGAACAGCCGACGGCCGAGCGCGAGATCATC
          TACGAGCTGTTCCAGCCGTGGGCCCTCAGCACATATGGCGATCAGGCCAAGACCAAGACGATAACATTGCGCAAGAAGGC
          GCGAATTCTTAAAGCCCTCGAGGGCAAGGAGCACAGTCGTCCCGATAGCTCCAAGTTCCGCTTTTGGGTCAAGACAAAGG
          GCTTCACTACTAATCGACCCGAGGGCTTTGAAGAGGCACCAGGCAGTCGGCGCCACCTGAAAAATCTTCCTAGCTCGGCC
          ATTTTGTCGGATAATCCCGCTGATGTGGACCTATTTGCCGCATCCACCAGCAAGGGATTCGGTCGAAGGACCTACCGCAA
          AGTGGCCTGTGTGGAAGAGTTCTTCGACATCATCTACAATGTGCACATGGAGCTGGGAGGTCGCAGTGGCATGCACGCGG
          GTCAAAAGCGCACCTACCGCATTATCACTGAAACCTATGCGTTCTTGCCCCGTGAGGCGGTCACCCGCTTCCTAACCATT
          TGTCCCGAGTGCAAGAAGAACCTTCGCCCCTCCTCACCATCGGGGGGTGGAAAAGACTCCGACCTGGCCGGCAATGAGAG
          CTCCTCCGAAGTGGAGAACTACCTCAATTACTCATCGCACACGGAGAGCTCGCTGGAGGCGGGGCCAACTGCCAAGCGCC
          GTCGGCACTCGAGCGCCGAAATCAAGGCCTCACTGGCCAGTGGCTTGGCTGTGGGTGCGGGAGTCGCCAGCAGCATGAGT
          GCCACTCAGCTGGATGTCCTGTGGACTGGAGTGCCCAGAAGTCGAAGTCCAAAGCCCCCGATGGCGGCAGAGGCGGCTGT
          TGAAACCACACCTGTTAGCGTGCCCAAAATCCGCATCAAGACCCAGTTGCAGCGTCCGTCGAGTCCGCAAGATCAGTCCC
          CTGCTGACCCGAACACCGATGCCCAATCCCAATCTCAGATCCAATCCCAGTCCCAATCTCAGTCACAGTCACAGTCACAA
          TCCCATTCACAGCCAAGTGGCCAAGGCTTTGATGCACAGCTGCTAAAGTCGCGGGATAATCTGCTGCGATACTATAACTT
          CATGAGGCGCTTCTATGCCGGGGAACCGGTTTTAGCACCGCCCATCTACGGCAGCAGCCTGTTGCAGAGCCTCAGCTATC
          CAACCACCATCTCAACCGCGGCCACAGCAACCCCTACGACCCCTACCACAACCACATCAGCTCCTGGCAAGATGCTGGCC
          CCTCCCAAGACCGCGACTCCGCCACCAAATCCTCCCAAGATCAAGACCTCACCGGATAGCTTGTTGCGGGCACGCACTCC
          TCCCGTGGCTTCAACAGCCACCTCCGCCGCGCCCAAGGACGCAGCTCACACTCCGATTAATCTAACTAAATCTTTATTTT
          CTAGCCTTAAAACCGGACATGCGCCATCCACATCGACGCCAGTTCCACTCAAGCTGGAACTGCCCAGTCCACCGAAACCA
          CTGCCGGAACTACGCATTCCCCAACTGCGTGGAATGCCGCCTGTGGAGCTATCCTTGCCACTGCCGCCTTTGGATTTGGA
          GCGATTGAAGCCCATCACCTCGACATACTTGCAGTTGACACGCAGCATGGGACTCAGCGATGAGGATGCCTTGCGGTTCG
          ACAATCTGGAAACCATTCCGGCAACACCGGTCGTGAGCACCGACACAGCCAGCGTGGTTGGTGTGGGCGTTGGAGGTGGA
          GGAGGGGCGGCAGCTGGCGCAGGAGGCGGAGCAGGTGGCGCTGGCGGACTCCTGGGCGATGTGGTCAGTGGACTGGGCGG
          CGGCCTCGTCAACGAGTCCGAGGCCTACGCCGGCCTGATGAAGGACGCGGATAAGCTGAAGCTAATGCTACTAGCCTGGA
          ACTACCAGAACTCGACGGCGGTGCGAAATGGAACCGAGGGTCCCGATCTGAGTGTGGTGGGTGGTCTGTGGGCGCAGTAC
          CAGAACGCTCTGGCCCAAAACGCGGCAGCTGCGGCGGCGGCCAGTGGCAAGATGGACAGTTCGCTGTCGCCGGTGCCGCG
          ACAAGATGCCCACTCGCCCATGGAGACGCAGGACGAGACTAACTCCTCCGGCCAGAAGGAGGAGGACGAGGTATCCGAGG
          ATGACTCCGATGACAAGCTGGACGAGAAACTGGCCACCACACACGATCCCGAGCGGCTCAAAGCCTTCAATATGTTTGTG
          CGGCTGTTTGTTGATGAGAATCTCGATCGCATCATTCCCATCTCGAAGCAGCCCAAGGAGAAGATTCAGGCCATTATCGA
          TTCATGCGCCCGGCAGTTCCCGGAGTTTAGCGATCGATCCCGCAAACGCATCCGCACCTATCTGAAATCGTGTCGGCGCA
          ACAAGAAGACCCGCGATGGATGGGAGAATACGACTCGACCCACTCCCGCTCATCTGACATCCGTGCAGGCGGAGCAAATC
          CTGGCCATTGCCTGCGAGAACGAATCTATGAACGCCAAACGAATGCGCATCGGCCTGGAGCCCATCACGCACGCAGTTCC
          CGCTCCTGGAAGTGCGGTGGCCGCTGCTGCAGCCGCGGCTGCGGCCGCAGCGGTGGTCGCTGCCACAAGTTCCAGTGCCG
          GCGGCACCAGCACCACGGCTGCCGGCAATGCCACAGCTACCTGCGGCATGGGCGGTGTGGGGGATGCCACCGGACTGACC
          AGCGCGGCAGCCGCAGCCCTTCCGTTCGTCAGCGCCGTCGGCTTCGCCCGCTCCACGCCCAATTCGGAGCACGCGGATGT
          CCTGCCCTTCGGAGGGGCGGGCACTGCAGGTGGCAGCGGGGGCGGTGGAGCCGGAGGCGGAGGCGGGGGTGGTATGAGCT
          CGGCGCGCAGCTCTCCCTTGGCCCTCAGCTCGAATGCCAGCGTTAGTGGTGGCGCCAGCGTCACCGGATTGACCCTCGCC
          AATGGAGCAGGCGCCTCCAACGGAGCTGGTCTGCCGGCCAGCAGTCCGTACACCACGGACTTTAGCTCCCCCTCGACGGC
          CTCACCATTTGTCGCAGCAGCTGCAGCCGTGGCCGCCGGCAGAGCCCCCAGCTATCCCGGATACTTCCCCGCAGTGGCTG
          GCCTGGGAAATGTTACGCCCACCGATCTCTCGATGAAACCGACCAGCGGCCTTGGCGGCAACATGGTCAGCAACAACAAC
          AGCAACAGTTCCGTGACCGGCAACATTAACTCGCAGCTAAGCGCCGCCAATTTGGCCAGCCTGAGCAATGCGAGCAACAA
          CAACGCATTGGTGACCGCCACCCAGCAGTTGCAGCAGCTGCAGCAGCAACAACAGCAGCAACAACAGCAACAGCAACAAC
          AGCAGCAACAACAACTGCTGGTGGCCGGCGGCGGCGGGATGGACGGCCAATCCGTTCGAGCGCCGCCCATCCTGCCGCAC
          AAACTGAGCGCCAACGAGGTGACGGCCGCCCGGCAGGTGATATCCGCTTACCGCGAGAGTGCCGCCTTCCTGCTCCGCAC
          CGCCGACCAGGTGGAGCAGCTGCTCGTCCAGCAGCAGTAGGCGTTGCCCGTGGTGGGGATGGGGTTGTTCCTATTTTAAA
          TTAAATTTAAAATAAATTACACACACTGCAAACAAAAGAGACACACACATAAGCCAAACTAAGCGAAAATAGTCAAACCA
          TATAGCGCAAAACTGAGACGACTAACACTTTCTCACAGGATGCAAGGCAGAACCATATGTAGCTAAAGAAGTTCGTTCAA
          ACAAAACATTTTAAGTGTTTTTTCCTCCAACTACGTACAGCATATTTAAAATAGAACTTAACGATAAACAAAAACCAAAA
          GAAATATTGCAAATATCACAACAGTAAAATAGTAGAGCTGCTTGGTACTGAGCTCAATTCGAGATTTTAACCACATTCAA
          CTTCGGTTTCCATAGACATTAGAAGATATTCACTCTAGGGATGGTTTCAATACATTCTATTCAACTTTCTTCCGAATTTC
          CTTCAATTTCCTTAAACGAATTCCTTAAATACGACTTAGATTAGATGCAATTCAGATACCAAGGCGGCTCTAATAAAAGT
          AAAGCCAAGCAGCAGTTCAACGTACTACAGTGTCTACTAAAAGTAAACCTACAATAGCCATACACAAACACTCGCATTCA
          TTTTGTTCAACTTTTATTAACGCATTTTTTTGGACTCTCAATCCTTTGGATAGCCGCAGATTCTGGGCCGGTTTTTAAGG
          TGCGCGATTTGTTAAAAAATTTAAATATGATAAATAAGTTAAAGTATTGTTGTAAATTTTAAGAAAACGGAAAACAGAAG
          AAAAAAACAAAAAAAAATCGTAAAACTATGAGAAAACACAGGGTGATACTTTGAGAAATTATTACAATGCATAAGATAAA
          AATTAATTAAAGAAAATGTAAAAAAAATTTATGGAAATGAGGTAAGGCATAGATGTTGGTAAATGTGTATTTAAAGTTTA
          GAAATTACAATTACAATTTGTATACTGTTCAGGATTTATTGTTCTCGATTACCATCATCTGAGTTTTTATCTTATTTCAT
          TTTTATTAGGTGTATATAATTTTAAAGTTTTTATTCTGAGACATTTATGTTTAACTGTTGCTTTTTACTCACCTTTGATT
          ATTGAATATAGATACGGAATAAAATAATTAAATACAAAATAGCATTTCATGTTTTTTGCAAATATAAATGTGCATGTTAA
          AATAAGAAACACTTACACAAACTCATAGAAACACATGGAACATTGGTATGTATGAGTGTGCAGAACGACATGAAGATCCG
          CTATGCAAGGCAAATTATAGAATTTAATTATATAAATTAATTGCTAAAATTATTTAACCACAAATAATTATGACTAAACC
          AACATAAATACTCCAAACGAACTTGATGGCTTGCAGGAGAAATATTTATACGGAATACTTAAATATAATGTAATGTGTGG
          CATTTGCATTGAAGAGTAAACTAATTAAACAAACACGAGGACAACACAAATGAAACAAGACATTTTAAAAATCGAATTAA
          TAAAGAATTTATGAGAATTATATGTACATTAC
          
          Other Products of this Gene
          Other Transcripts
          Name
          FlyBase ID
          Length (nt)
          FBtr0445731
          2385
          FBtr0445729
          4048
          FBtr0445732
          2458
          Polypeptides
          Derived from THIS transcript
          Name
          FlyBase ID
          Length (aa)
          FBpp0401605
          1237
          Derived from OTHER transcripts
          Name
          FlyBase ID
          Length (aa)
          FBpp0401606
          623
          FBpp0401604
          636
          FBpp0401607
          667
          Comments

          Transcript terminates at site supported by polyadenylated cDNA.

          Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).

          External Crossreferences and Linkouts ( 1 )
          Crossreferences
          RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
          Synonyms and Secondary IDs (1)
          Reported As
          Symbol Synonym
          CG46301-RE
          Secondary FlyBase IDs
            References (0)