Open Close
General Information
Symbol
Dmel\CG46301-RC
Species
D. melanogaster
Annotation Symbol
CG46301-RC
FlyBase ID
FBtr0445731
Feature type
Associated gene
Evidence Rank
Length (nt)
2385
Evidence Score
Genomic Location
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
    Contained within the annotated transcript, internally consistent
      End(s) extend beyond the annotated transcript, internally consistent
        cDNA Clones, End Sequence Only (ESTs)
        Contained within the annotated transcript, internally consistent
          End(s) extend beyond the annotated transcript, internally consistent
            Sequence
            TTGAACTTTCATTCGGTCGCGTCGCGTTCGCTGTTACTCATTTCTTTTTTGGCCTTTGGTTATTTGTTGGGCCGAAAAGA
            TCTGAACCCTGTTTTTCGTTTTTGTGGGATTTCTGTTATACTTTTAATATTGTTAAAAAGAAAACTCATCGTTTTGTTGA
            CTTTTTTAGTTAAATATTTGTTCAAAAAATTTGTGTCTGATATTTTGCCAAGTTTAACATACAAAAAGGACATTCCGAGA
            AATCCCACCAAACGAAGAATTGAATTCAGCTGAAATTCTAATTTCACACAAAATTCTTCCCAAAACACCCCATGTCATCG
            ATTATCGCTTGCAGTTGTCTTTGATTTGCTGTTTTTTGAGTCCCTTAAACAGTGTGTGCTTGAGTTGAGCCCCCCAAATT
            CGCATCATGGAGCACTCGAATGGCAGTGGCAAGCCTCGTACAGACCAGTCTGCGTCACCTAACCCACAGTCCTCGGCGAT
            GACTGCCTCGTCGGAGGGTTGGAGCAGCAAAAGGAAGCTCTATGCCATCGATGAGCGCGAGGAGAGCTCGCCAGTGACTG
            TGGGCAAGGTGGAGACTGATTTGGCCTACGATGCGGATGTGGACGAGCTGGAACAGCCGACGGCCGAGCGCGAGATCATC
            TACGAGCTGTTCCAGCCGTGGGCCCTCAGCACATATGGCGATCAGGCCAAGACCAAGACGATAACATTGCGCAAGAAGGC
            GCGAATTCTTAAAGCCCTCGAGGGCAAGGAGCACAGTCGTCCCGATAGCTCCAAGTTCCGCTTTTGGGTCAAGACAAAGG
            GCTTCACTACTAATCGACCCGAGGGCTTTGAAGAGGCACCAGGCAGTCGGCGCCACCTGAAAAATCTTCCTAGCTCGGCC
            ATTTTGTCGGATAATCCCGCTGATGTGGACCTATTTGCCGCATCCACCAGCAAGGGATTCGGTCGAAGGACCTACCGCAA
            AGTGGCCTGTGTGGAAGAGTTCTTCGACATCATCTACAATGTGCACATGGAGCTGGGAGGTCGCAGTGGCATGCACGCGG
            GTCAAAAGCGCACCTACCGCATTATCACTGAAACCTATGCGTTCTTGCCCCGTGAGGCGGTCACCCGCTTCCTAACCATT
            TGTCCCGAGTGCAAGAAGAACCTTCGCCCCTCCTCACCATCGGGGGGTGGAAAAGACTCCGACCTGGCCGGCAATGAGAG
            CTCCTCCGAAGTGGAGAACTACCTCAATTACTCATCGCACACGGAGAGCTCGCTGGAGGCGGGGCCAACTGCCAAGCGCC
            GTCGGCACTCGAGCGCCGAAATCAAGGCCTCACTGGCCAGTGGCTTGGCTGTGGGTGCGGGAGTCGCCAGCAGCATGAGT
            GCCACTCAGCTGGATGTCCTGTGGACTGGAGTGCCCAGAAGTCGAAGTCCAAAGCCCCCGATGGCGGCAGAGGCGGCTGT
            TGAAACCACACCTGTTAGCGTGCCCAAAATCCGCATCAAGACCCAGTTGCAGCGTCCGTCGAGTCCGCAAGATCAGTCCC
            CTGCTGACCCGAACACCGATGCCCAATCCCAATCTCAGATCCAATCCCAGTCCCAATCTCAGTCACAGTCACAGTCACAA
            TCCCATTCACAGCCAAGTGGCCAAGGCTTTGATGCACAGCTGCTAAAGTCGCGGGATAATCTGCTGCGATACTATAACTT
            CATGAGGCGCTTCTATGCCGGGGAACCGGTTTTAGCACCGCCCATCTACGGCAGCAGCCTGTTGCAGAGCCTCAGCTATC
            CAACCACCATCTCAACCGCGGCCACAGCAACCCCTACGACCCCTACCACAACCACATCAGCTCCTGGCAAGATGCTGGCC
            CCTCCCAAGACCGCGACTCCGCCACCAAATCCTCCCAAGATCAAGACCTCACCGGATAGCTTGTTGCGGGCACGCACTCC
            TCCCGTGGCTTCAACAGCCACCTCCGCCGCGCCCAAGGACGCAGCTCACACTCCGATTAATCTAACTAAATCTTTATTTT
            CTAGCCTTAAAACCGGACATGCGCCATCCACATCGACGCCAGTTCCACTCAAGCTGGAACTGCCCAGTCCACCGAAACCA
            CTGCCGGAACTACGCATTCCCCAACTGCGTGGAATGCCGCCTGTGGAGCTATCCTTGCCACTGCCGCCTTTGGATTTGGA
            GCGATTGAAGCCCATCACCTCGACATACTTGCAGTTGACACGCAGCATGGGACTCAGCGATGAGGATGCCTTGCGGTTCG
            ACAATCTGGTGAGTAAGGACTTCAAGTACTCGCTGTAGACCTAAGCGAATGTTGAGAATGTATTTGAGAAGTTATGATAG
            TTTCCACTACGGTTAGTTGAATGGAAACATCCGATCTCAAATGAGCAATCACAGTTTTATTGAGC
            
            Other Products of this Gene
            Other Transcripts
            Name
            FlyBase ID
            Length (nt)
            FBtr0445729
            4048
            FBtr0445730
            5632
            FBtr0445732
            2458
            Polypeptides
            Derived from THIS transcript
            Name
            FlyBase ID
            Length (aa)
            FBpp0401606
            623
            Derived from OTHER transcripts
            Name
            FlyBase ID
            Length (aa)
            FBpp0401604
            636
            FBpp0401605
            1237
            FBpp0401607
            667
            Comments

            Transcriptional initiation is supported by RAMPAGE TSS data (FBrf0220331).

            External Crossreferences and Linkouts ( 1 )
            Crossreferences
            RefSeq - A comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein.
            Synonyms and Secondary IDs (1)
            Reported As
            Symbol Synonym
            CG46301-RC
            Secondary FlyBase IDs
              References (0)