Imprecise excision of the progenitor insertion, resulting in a 662bp deletion that removes the 5' third of Ef1γ, including the translation start site. 21bp of the original insertion remain.
A 662 bp deletion associated with the imprecise excision of P{EP}eEF1gammaGE29510. 21 bp of the P element remain at the site of the excision.
CATGATGAAATAACATCCTGC
lethal (with Df(3R)Exel6212)
lethal (with eEF1γGE29510)
Homozygous clones are not recovered in the adult eye.
BicDr, eEF1γA70 has visible | adult stage phenotype
BicDR71, BicDr, eEF1γA70 has visible | adult stage phenotype
BicDR71, eEF1γA70 has visible | adult stage phenotype
BicDr, eEF1γA70 has macrochaeta phenotype
BicDR71, BicDr, eEF1γA70 has macrochaeta phenotype
BicDR71, eEF1γA70 has macrochaeta phenotype
eEF1γA70 is rescued by eEF1γUAS.cFa/Scer\GAL4da.G32
eEF1γA70 is partially rescued by Scer\GAL4da.G32/eEF1γS294A.UAS