The P{EPg} element from P{EPg}Ccm3HP36555 has been imprecisely excised, leaving behind a small insertion that introduces extraneous coding sequence and an in-frame stop codon.
P{EPg}Ccm3HP36555 was imprecisely excised and left behind extranious sequences that introduce a stop codon. Inserted sequences are GATGAAATAACATGTTATTTCATGCTGCGGCCCAT.
GATGAAATAACATGTTATTTCATGCTGCGGCCCAT
No tracheal morphogenesis defects are seen in heterozygous Ccm3ins mutant third instar larvae.
Ccm3[+]/Ccm3ins is an enhancer of terminal tracheal cell | third instar larval stage phenotype of GckIIIKK101915, Scer\GAL4btl.PS
Heterozygosity for Ccm3ins enhances the penetrance of the transition zone tube dilation defect seen in third instar larval trachea expressing GckIIIKK101915 under the control of Scer\GAL4btl.PS.
This line contains a lethal mutation elsewhere on chromosome three.