Amino acid replacement: K872M.
Catalytically dead version of sxc caused by K872M amino acid replacement; also includes silent mutations in adjacent codons.
AAA5327665ATG
AAA?ATG
K872M | sxc-PA; K872M | sxc-PB; K872M | sxc-PC
K872M
Two bases of codon 872 are changed in the mutant (AAA to ATG) resulting in a K872M amino acid change. There are also six silent substitutions with in the next six codons. The sequence change in the region of codons 872 to 578 is AAAATCGATCCACAAACCCTC to ATGATCGACCCGCAGACGTTG.
sxcK872M has decreased size | larval stage phenotype, non-enhanceable by OgaKO
sxcK872M has decreased size | larval stage phenotype, non-suppressible by OgaKO
sxcK872M has embryonic/larval neuromuscular junction | larval stage phenotype, non-enhanceable by OgaKO
sxcK872M has NMJ bouton | larval stage | decreased number phenotype, non-enhanceable by OgaKO
sxcK872M has embryonic/larval neuromuscular junction | larval stage phenotype, non-suppressible by OgaKO
sxcK872M has NMJ bouton | larval stage | decreased number phenotype, non-suppressible by OgaKO
sxcK872M is partially rescued by sxcUAS.cMa/Scer\GAL4elav.PLu
sxcK872M is not rescued by Scer\GAL4Mhc.PK/sxcUAS.cMa