645bp deletion that removes a Polycomb response element (PRE) located close to the 5' end of the dac gene.
CGGACATATGCACACCTGCGATCATAACTTCGTATAATGTATGCTATACGAAGTTATAGAAGAGCACTAGTAAAGATCTCCATGCATAAGGCAACGGTAGCGCTTCGTGTGTACGTAT
dacΔPRE2 homozygous adult males frequently show an ectopic sex comb on the T2 prothoracic leg segment; the phenotype progresses to almost full penetrance from 21[o]C to 28[o]C.
dacΔPRE2 has prothoracic tarsal segment 2 | male phenotype, enhanceable by ph-p410