A single base substitution (T to G at X:18571665 ) in the seed sequence of one of two mir-263b binding sites within the 3' UTR of Bx. This change is in the context of five base substitutions and two bases deleted in the vicinity. The net change is that the annotated region (ACGCTCGAAGCGTGCCGTGCCAAAAG) is replaced with CCCCCCGACGTGCGGGGCCAAAAA.
CCCCCCGACGTGCGGGGCCAAAAA
Bxmut1-miR-263b adults show decreased circadian rhythmicity and circadian power under constant dark, and show decreased morning anticipation activity under light-dark cycles, as compared to wild-type controls.