A single base substitution (A to G at X:18571692 ) in the seed sequence of one of two mir-263b binding sites within the 3' UTR of Bx. This change is in the context of sa total of seven base substitutions in the vicinity. The net change is that the annotated region (GCTCGAAGCGTGCGGTGCCAAAAGAAATTCAAAGCAGTGCCAA) is replaced with CCCCCAAGCGTGGGGTGCCAAAAGAAATTCAAGACAGTGCCAG.
CCCCCAAGCGTGGGGTGCCAAAAGAAATTCAAGACAGTGCCAG
Bxmut2-miR-263b adults show decreased circadian rhythmicity and circadian power under constant dark, and lack morning anticipation activity under light-dark cycles, as compared to wild-type controls.
Bxmut2-miR-263b adults show disrupted circadian plasticity of sLNv dorsal projections, as mutants show a lower number of axon terminal branches at ZT2 than controls.