A TI{CRIMIC.TG4.1} DNA cassette has been inserted into CG17739, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of CG17739 downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.1} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target CG17739 : one targeted to a coding intron (TATATACTTTAATCCTGTAGCGG) and the other to a non-coding exon in the 3' UTR (AACTATGTAATCATTACCAATGG).
axon (with DrospEY18336)
DrospCR70269-KO-TG4.1 has abnormal neuroanatomy | dominant phenotype, enhanceable by LpR1CR70219-TG4.0
DrospCR70269-KO-TG4.1 has abnormal neuroanatomy | dominant phenotype, enhanceable by LpR2CR70220-TG4.0
DrospCR70269-KO-TG4.1 has abnormal neuroanatomy | dominant phenotype, suppressible by Hsap\RELNUAS.cRa.Tag:HA/Scer\GAL4Drosp-CR70269-KO-TG4.1
DrospCR70269-KO-TG4.1 has decreased size phenotype, suppressible | partially by Hsap\RELNUAS.cRa.Tag:HA/Scer\GAL4Drosp-CR70269-KO-TG4.1
DrospCR70269-KO-TG4.1 is an enhancer of abnormal neuroanatomy | dominant phenotype of LpR1CR70219-TG4.0
DrospCR70269-KO-TG4.1 is an enhancer of abnormal neuroanatomy | dominant phenotype of LpR2CR70220-TG4.0
DrospCR70269-KO-TG4.1 has mushroom body phenotype, enhanceable by LpR1CR70219-TG4.0
DrospCR70269-KO-TG4.1 has mushroom body phenotype, enhanceable by LpR2CR70220-TG4.0
DrospCR70269-KO-TG4.1 has axon phenotype, enhanceable by LpR2CR70220-TG4.0
DrospCR70269-KO-TG4.1 has mushroom body phenotype, suppressible by Hsap\RELNUAS.cRa.Tag:HA/Scer\GAL4Drosp-CR70269-KO-TG4.1
DrospCR70269-KO-TG4.1 has mushroom body medial lobe phenotype, suppressible by Hsap\RELNUAS.cRa.Tag:HA/Scer\GAL4Drosp-CR70269-KO-TG4.1
DrospCR70269-KO-TG4.1 has central brain phenotype, suppressible | partially by Hsap\RELNUAS.cRa.Tag:HA/Scer\GAL4Drosp-CR70269-KO-TG4.1
DrospCR70269-KO-TG4.1 has axon phenotype, suppressible by Hsap\RELNUAS.cRa.Tag:HA/Scer\GAL4Drosp-CR70269-KO-TG4.1
DrospCR70269-KO-TG4.1 is an enhancer of mushroom body phenotype of LpR1CR70219-TG4.0
DrospCR70269-KO-TG4.1 is an enhancer of mushroom body phenotype of LpR2CR70220-TG4.0
DrospCR70269-KO-TG4.1 is an enhancer of axon phenotype of LpR2CR70220-TG4.0